9917
Spread the love

Die Tiefensequenzierung der bivalenten Impfstoffe von Moderna und Pfizer identifiziert die Kontamination von Expressionsvektoren, die für die Plasmidamplifikation in Bakterien entwickelt wurden.Deep sequencing of the Moderna and Pfizer bivalent vaccines identifies contamination of expression vectors designed for plasmid amplification in bacteria.

16. Februar 2023February 16th 2023

EinführungIntroduction

Da Universitäten in den Vereinigten Staaten weiterhin haftungsfreie Injektionen (COVID-Impfstoffe) für Studenten mit begrenztem Risiko einer Ansteckung mit COVID vorschreiben, wird es zwingend erforderlich, dass mehr öffentliche Informationen über die Inhaltsstoffe dieser experimentellen Impfstoffe verfügbar gemacht werden. Sowohl die As universities in the United States continue to mandate liability-free injections (COVID vaccines) for students at limited risk of contracting COVID, it becomes imperative that more public information be made available for the ingredients of these experimental vaccines. Both the EMA EMA als auch die and the TGA haben TGA fragmentierte RNA und verschmierte Western Blots zur Kenntnis genommen, have made note of was darauf hindeutet, dass es dem Impfstoffherstellungsprozess an Genauigkeit und Transparenz mangelt. Kurz nach der Veröffentlichung der TGA-Daten stellten Patel et al . (Pfizer) veröffentlichte ein Papier, in dem versucht wurde, diese Bedenken zu entschärfen. Jessica Rose hat dieses Thema hier behandelt.fragmented RNA and smeary western blots suggesting the vaccine manufacturing process lacks fidelity and transparency. Shortly after the TGA data was released, Patel et al. (Pfizer) published a paper attempting to defuse these concerns. Jessica Rose has covered this topic here.

Mit schlecht charakterisierten Therapeutika kann keine Einwilligung nach Aufklärung eingeholt werden.Informed consent cannot be obtained with poorly characterized therapeutics.

Wir treten jetzt in das dritte Jahr von COVID ein und es wird immer deutlicher, welche Bevölkerungsgruppen gefährdet sind. Es wurde wiederholt gezeigt, dass die Altersgruppe der Studenten (unter 25) ein sehr geringes COVID-Risiko hat, aber die durch den Impfstoff verursachten unerwünschten Ereignisse für Studenten in dieser Altersgruppe sind höher als bei jedem jemals verabreichten Impfstoff. Kruget We are now entering the third year of COVID and its has become increasingly clear which demographics are at risk. The student age group (under 25) has repeatedly been shown to have very low risk of COVID yet the vaccine induced adverse events for students in this age bracket is higher than any vaccine ever administered. Krug al. et al.beobachteten ein Risiko von 1:6250 für Myo-/Perikarditis bei 16- bis 17-Jährigen ( observed a risk of 1:6250 risk for myo/pericarditis in 16-17 year olds (Krug et al Krug et al.).).

 

Mansanguanet al.Mansanguan et al.

Die „ The “Thailand-Studie“ Thailand study” (Mansanguan (Mansanguanet al. et al) impliziert noch höhere kardiale Risikoraten für Studenten, bei denen 29,24 % der Studenten (n=301) kardiovaskuläre Manifestationen aufwiesen. Studien mit 23 ) implies even higher rates of cardiac risk for students, where 29.24% of students (n=301) experienced cardiovascular manifestations. Studies including 23 Millionen nordischen Patienten Million Nordic patients beobachteten auch in dieser Altersgruppe eine signifikante Myokarditisrate. Diese Studie war zwar größer, aber nicht so kontrolliert wie die Thailand-Studie, in der Mansanguan observed a significant rate of myocarditis in this age group as well. This study, while larger, was not as controlled as the Thailand study in that Mansanguan et al. et al.nahm grundlegende Messungen der Patienten vor und untersuchte mehr als nur Myo/Perikarditis. took baseline measurements of the patients and explored more than just myo/pericarditis.

Diese Risiken werden These risks are not bei C19 selbst nicht gesehen seen with C19 itself..

Tuvali et al.Tuvali et al.

Ähnliche Ergebnisse sind bei Similar results are seen in Aquaro Aquaro et al. et al.und Sechi et al. wobei sich die C19-bedingte Myokarditis nicht von den Hintergrundraten unterscheidet. and Sechi et al. where C19 derived Myocarditis is no different than background rates.

Aquaroet al.Aquaro et al.

Eine A Metaanalyse bestätigt dies.meta analysis confirms this.

Dieser Unterschied im Herzrisiko zwischen dem Impfstoff und dem Virus sollte nicht überraschen. Die intramuskuläre (IM) Verabreichung bringt einen sofortigen potenziellen Zugang zum Gefäßsystem mit sich. Studien, die qualifizierte Krankenschwestern mit Aspirationstechniken bewerten, This difference in cardiac risk between the vaccine and the virus should come as no surprise. Intramuscular (IM) administration comes with immediate potential access to the vasculature system. Studies evaluating skilled nurses using aspiration haben eine Rate von 1,9 % techniques have a 1.9% rate, eine Vene oder eine Arterie zu treffen. Die versehentliche IV-Injektion in of hitting a vein or an artery. Accidental IV injection in der Zahnmedizin ist mit 4 % Dentistry is even higher at 4%bei Aspiration sogar noch höher. SARs-CoV-2-Impfstoffe erfordern nicht einmal eine Aspiration und haben wahrscheinlich eine höhere versehentliche IV-Injektionsrate. Marc Girodot hat with aspiration. SARs-CoV-2 vaccines do not even require aspiration and likely have a higher accidental IV injection rate. Marc Girodot has dies ausführlich behandelt.covered this in detail.

Auf der anderen Seite dieser Risikogleichung stellen wir fest, dass eine Infektion durch C19 nachweislich eine dauerhaftere Immunität bietet als die auf Narrow- On the flip side of this risk equation we find infection from C19 has been shown to provide more durable immunity than the narrow Spike-Proteine ​​fokussierten Impfstoffe spike protein focused vaccines. Die natürliche Immunität bietet Schleimhaut-Antikörper und T-Zell-Erkennung des Proteoms, das aus dem gesamten 30-kb-Virusgenom stammt, wobei sich die Impfstoffe auf eine kleine ~4-kb-Region (1273 Aminosäuren) des Virus konzentrieren.. Natural immunity provides mucosal antibodies and T-Cell recognition of the proteome derived from the entire 30kb viral genome where the vaccines are focused on a small ~4kb (1273 amino acids) region of the virus.

Diese Narrow-Epitop-Impfstoffstrategie hat nun Escape-Mutanten dokumentiert, bei denen die Mehrheit der Mutationen von Delta bis Omicron Aminosäure-ändernde Varianten in der Spike-Domäne sind, auf die das Impfstoffprogramm abzielt. Diese Anreicherung an aminosäureverändernden Varianten gegenüber synonymen Varianten ist das This narrow-epitope vaccine strategy, now has documented escape mutants where the majority of the mutations from Delta to Omicron are amino acid changing variants in the spike domain targeted by the vaccine program. This enrichment in amino acid changing variants over synonymous variants is the Kennzeichen der Selektion hall mark of selection. Impfstoffe, die die Übertragung nicht stoppen und die Viruslast des Patienten nicht begrenzen, lassen die evolutionäre Uhr des Virus (RdRp-Polymerase) intakt, sondern steuern lediglich die Evolution um das Paddel herum, das Sie in den Fluss gesetzt haben. . Vaccines that don’t stop transmission and fail to limit the viral load of the patient, leave the evolutionary clock of the virus (RdRp polymerase) intact but merely steer evolution around the paddle you placed in the river. Chau Chau et alet al . zeigten höhere Viruslasten bei den Geimpften. Die Studie durchlief mehrere Varianten, aber andere Studien deuten auf eine gleich leicht . demonstrated higher viral loads in the vaccinated. The study traversed multiple variants but other studies suggest equal to slightly niedrigere Viruslast bei den Geimpften hinlower viral loads in the vaccinated. Selbst in diesen Fällen beträgt die Varianz einige CTs und liegt im Bereich von 10^8. . Even in these cases the variance is a few CTs and in the 10^8 range. Dahdouh Dahdouh et al. et al.zeigten allein beim Abstrich bis zu 10 CT-Varianzen, was auf viele Störfaktoren für diese Studien hindeutet. Die kleine CT-Änderung liegt im Bereich von 100 Millionen Molekülen und ist sowohl bei Geimpften als auch bei Ungeimpften so hoch, dass ein Unterschied von 2 CT angesichts der um Größenordnungen niedrigeren Anforderungen an eine minimale Infektionsdosis (10 ^ 6) irrelevant showed up to 10 CT variances in swabbing alone suggesting many confounders to these studies. The small CT change is in the 100 million molecule range and is so high in both the vaccinated and unvaccinated that a 2 CT difference is irrelevant given the orders of magnitude lower requirements for a ist minimum infective dose. (10^6).

Chau et al. „Vietnam-Studie“Chau et al. ‘Vietnam study’

Es ist allgemein bekannt, dass diese Impfstoffe die Übertragung nicht stoppen, und neuere Studien der It is is well established that these vaccines do not stop transmission and recent studies from the Cleveland-Klinik Cleveland clinic (Preprint) zeigen sogar eine negative Impfstoffwirksamkeit bei jedem zusätzlichen Impfstoff. Sie zeigen auch eine dosisabhängige Wirkung oder einen „biologischen Gradienten“, der einer der Grundsätze der (preprint) even demonstrate negative vaccine efficacy with each additional vaccine. They also demonstrate a dose dependent effect or a ‘Biological gradient’ which is one of the tenets of the Bradford-Hill-Bedingungen Bradford Hill conditionsfür Kausalität ist. Dies bedeutet, dass die Impfstoffe das Immunsystem der Patienten schwächen und sie anfälliger für C19 und andere Infektionen machen. for causality. This implies the vaccines are weakening patients immune systems and making them more susceptible to C19 and other infections.

Daher scheinen die Impfrichtlinien an Universitäten gegen die grundlegende medizinische Ethik zu verstoßen, da sie von den Studenten verlangen, ein negatives Risiko/Nutzen-Verhältnis medizinischer Intervention zu tragen, um ältere Fakultäten zu schützen. Dies benutzt ihre Studentenschaft als menschliche Schutzschilde, ohne darüber zu informieren, dass das Schild einen „Russischen Roulette“-Preis für seinen Benutzer hat. Dies ist falsch informierter Zwang, keine informierte Zustimmung.Thus the vaccination policies at universities appear to violate fundamental medical ethics as they are asking students to absorb a negative risk/benefit medical intervention to shield older faculty. This is using their student body as human shields while failing to inform that the shield has a ‘Russian Roulette’ price for its user. This is mis-informed coercion not informed consent.

Dies gilt insbesondere für Impfstoffe, die die Übertragung nicht stoppen und in mehreren Studien Anzeichen einer negativen Impfstoffwirksamkeit zeigen ( This is particularly true for vaccines that do not stop transmission and in several studies show signs of negative vaccine efficacy (Barnstable Mass Barnstable Mass). Die von der CDC durchgeführte Barnstable Mass-Studie zeigte höhere Infektionsraten unter den Geimpften. ). The Barnstable Mass study run by the CDC showed higher infection rates amongst the vaccinated. Australien Australiaist jetzt zu 96 % geimpft (16 + 2 Dosen) und die Krankenhäuser sind zu über 96 % für geimpfte Patienten angereichert. is now 96% vaccinated (16+ 2 Doses) and the hospitals are enriched above 96% for vaccinated patients. Die Übersterblichkeit in Australien Excess mortality in Australiaist nach der Impfung höher als während der Pandemie vor der Impfung. is higher post vaccination than during the pre-vaccination pandemic.

Die bivalenten Booster wurden in dieser Altersgruppe der Schüler nie ausreichend untersucht. The bivalent boosters were never adequately studied in this student age group. Paul Offit was quoted as saying Paul Offit wurde in Bezug auf die Zulassung dieser Impfstoffe mit den Worten zitiert: „Der Fix war drin“ . “The fix was in”Anstelle groß angelegter RCTs wurden wie bei der bivalenten Booster-Zulassung überwiegend Mausdaten verwendet. Sogar die RCTs, die mit BNT162b2 und mRNA1273 durchgeführt wurden, wurden von regarding the approval of these vaccines. Instead of large scale RCTs, mouse data was predominantly used as for the bivalent booster approval. Even the RCTs that were performed on BNT162b2 and mRNA1273 have been reanalyzed by unabhängigen Forschern independent researchers(Fraiman et al.) erneut analysiert und für (Fraiman et al) and found to keinen Nutzen befunden have no benefit(Bardosh et al.). (Bardosh et al).

Byram Bridle erklärt, inwiefern die Byram Bridle explains how the selektive Vermarktung selective marketing des Relative Risk Reduction Score von Pfizer eine Verletzung der FDA-Richtlinie war. Trotzdem wurde er mit tosendem Applaus belohnt.of Pfizers Relative Risk reduction score was a violation of FDA policy. Yet it was met with thunderous applause.

Die ersten Impfstoffe, die auf das Wuhan-1-Spike-Protein abzielten, haben nie eine Qualitätskontrolle für die DNA-Sequenzierung von Charge zu Charge ermöglicht. Sie haben niemals Beweise für die Transkriptions- oder Translationstreue dieser Prodrugs geliefert. Dies ist von größter Bedeutung, da die Impfstoffe ein fehleranfälliges Nukleotid enthielten, das als N1-Methylpseudouridin (m1Ψ) bekannt ist und dafür bekannt ist, die Transkriptionsfehlerrate auf The initial vaccines that targeted Wuhan-1 spike protein have never provided lot to lot DNA sequencing quality control. They have never provided any evidence of transcriptional or translational fidelity of these pro-drugs. This is of utmost importance as the vaccines incorporated an error prone nucleotide known as N1-methyl-pseudouridine (m1Ψ) known to increase the transcriptional error rate to 250–300/Million oder 1 Fehler alle 4.000 Nukleotide zu erhöhen 250-300/Million or 1 error every 4,000 nucleotides(Chen (Chen et al et al.). Dies führt zu einem Fehler in jedem synthetisierten Impfstoffmolekül, und 14-34 Billionen werden mit Pfizer bzw. Moderna injiziert. Wenn sich die Einzelmolekül-Assays (Pacific Biosciences Sequencing), die zur Schätzung dieser Fehlerrate verwendet werden, in echten Studien am Menschen manifestieren, ist dies ein außerordentlicher Grad an Komplexität.). This translates into an error in every vaccine molecule synthesized and 14-34 trillion are injected with Pfizer and Moderna respectively. If the single molecule (Pacific Biosciences sequencing) assays used to estimate this error rate manifest in real human studies, this is an extraordinary degree of complexity.

Um die Sache noch schlimmer zu machen, ist der Einfluss dieser Base auf die Ribosomentreue unbekannt, aber die veröffentlichten Versuche, die Auswirkungen von Pseudouridinen (nicht N1-Methyl-pseudoU oder m1Ψ) auf die Treue zu modellieren, haben eine erhebliche Zunahme der ribosomalen Rahmenverschiebung, des Stoppens der Codonablation und gezeigt Übersetzungsfehler ( To make matters even worse, the impact of this base on ribosome fidelity is unknown but the published attempts to model pseudouridines (not N1-methyl-pseudoU or m1Ψ) impact on fidelity have shown substantial increases in ribosomal frame-shifting, stop codon ablation and translational error (Fernandez et al) Fernandez et al). Eine Studie, die vergeblich versucht hat, dies in Frage zu stellen, wird . A study that attempted to unsuccessfully challenge this is hier diskutiert discussed here..

Das Labor von Andrew Fire sequenzierte Andrew Fire’s lab sequenced die früheren Impfstoffe, versäumte es jedoch, jemals die rohen Sequenzierungs-Reads offenzulegen. Diese Daten werden benötigt, um Bedenken hinsichtlich Transkriptionsfehlerraten und Heteroplasmen auszuräumen.the earlier vaccines but failed to ever disclose the raw sequencing reads. These data are needed to address concerns over transcriptional error rates and heteroplasmies.

Für die neuartigen bivalenten Impfstoffe, die Kindern verabreicht werden, liegen keine öffentlichen Sequenzdaten vor. Über 50 Millionen der bivalenten Impfstoffe No public sequence data exists for the novel bivalent vaccines being administered to children. Over 50M of the bivalent vaccines wurden laut CDC have been administered according to the CDCzum Zeitpunkt dieses Schreibens verabreicht. as of this writing.

Pfizer prognostiziert starke Umsätze für 3 Jahre.Pfizer is forecasting strong sales for 3 years.

Bild

Da es nur begrenzte öffentliche QA/QC-Daten zu diesen bivalenten Impfstoffen gibt, haben wir versucht, die RNA-Integrität der bivalenten Impfstoffe von Pfizer und Moderna unabhängig zu überwachen. Probenfläschchen wurden gereinigt und mittels Elektrophorese bewertet. Direktionale RNA-seq-Bibliotheken wurden konstruiert und auf Illumina-Sequenzierern sequenziert.Since there is limited public QA/QC data regarding these bivalent vaccines, we sought to independently monitor the RNA integrity of Pfizer and Moderna bivalent vaccines. Sample vials were purified and evaluated via electrophoresis. Directional RNA-seq libraries were constructed and sequenced on Illumina sequencers.

Für den Impfstoff Pfizer Bivalent liegen EMA-Dokumente vom August 2022 vor. Diese Dokumente besagen, dass NGS-Daten (Next Generation Sequencing) existieren, aber nicht an die EMA geliefert wurden. Die EMA wies auch darauf hin, dass nur Western Blots zur Charakterisierung des übersetzten Produkts verfügbar seien und dass die Banden nicht den erwarteten Größen entsprächen.EMA documents from August 2022 exist for the Pfizer Bivalent vaccine. These documents state that NGS (Next Generation Sequencing) data exists but were not supplied to the EMA. The EMA also made note of there being only Western Blots available for characterization of the translated product and that the bands did not match the anticipated sizes.

Bildunterschrift von der EMA.Caption from the EMA.

 

MethodenMethods

Bilder und Chargennummern von Impfstofffläschchen. Pfizer-Fläschchen stammen aus derselben Charge. Moderna-Lots sind anders.Images and lot numbers of vaccine vials. Pfizer vials are from the same lot. Moderna lots are different.

Impfstoffchargennummern und QR-Codes.Vaccine Lot numbers and QR codes.

 

MethodenMethods

Reinigung der mRNA aus den LNPs.Purifying the mRNA from the LNPs.

100 ul jedes Fläschchens wurden als Probe entnommen (1/3 bis 1/5 einer Dosis).100ul of each vial was sampled (1/3rd to 1/5th of a dose)

  • 5 ul 2% LiDs wurden zu 100 ul Impfstoff gegeben, um LNPs aufzulösen5ul of 2% LiDs was added to 100ul of Vaccine to dissolve LNPs
  • 100 ul 100 % Isopropanol100ul of 100% Isopropanol
  • 233ul Ampure (Beckman Genomics)233ul of Ampure (Beckman Genomics)
  • 25 ul 25 mM MgCl2 (New England Biolabs)25ul of 25mM MgCl2 (New England Biolabs)

Die Proben wurden 10x mit der Spitze gemischt und für 5 Minuten zur Magnetperlenbindung inkubiert.Samples were tip mixed 10X and incubated for 5 minutes for magnetic bead binding.

Magnetperlen wurden auf einer Magnetplatte mit 96 Vertiefungen für 10 Minuten getrennt und zweimal mit 200 &mgr;l 80%igem EtOH gewaschen.Magnetic Beads were separated on a 96-well magnet plate for 10 minutes and washed twice with 200ul of 80% EtOH.

Die Kügelchen wurden 3 Minuten an der Luft trocknen gelassen und in 100 ul ddH&sub2;O eluiert. 2 ul der eluierten Probe wurden auf einer Agilent Tape Station laufen gelassen.The beads were left to air dry for 3 minutes and eluted in 100ul of ddH20. 2ul of eluted sample was run on an Agilent Tape Station.

BibliotheksbauLibrary Construction

50 ul jeder 100 ul-Probe wurden in RNA-Seq-Bibliotheken für die Illumina-Sequenzierung unter Verwendung des NEB NEBNext UltraII Directional RNA Library Kit for Illumina (NEB # E7760S) umgewandelt.50ul of each 100ul sample was converted into RNA-Seq libraries for Illumina sequencing using the NEB NEBNext UltraII Directional RNA library Kit for Illumina (NEB#E7760S).

Um Bibliotheken mit längeren Inserts anzureichern, wurde die Fragmentierungszeit von 15 Minuten auf 10 Minuten verkürzt und die Synthesezeit des ersten Strangs bei 42 °C auf 50 Minuten gemäß den Empfehlungen für lange Inserts im Protokoll verlängert.To enrich for longer insert libraries the fragmentation time was reduced from 15 minutes to 10 minutes and the First strand synthesis time was extended at 42C to 50 minutes per the long insert recommendations in the protocol.

Es wurde keine Ribo-Verarmung oder PolyA-Anreicherung durchgeführt, um die unvoreingenommenste Bewertung aller Fragmente in der Bibliothek bereitzustellen. Die Bibliothek wurde für 16 Zyklen gemäß dem Protokoll des Herstellers amplifiziert. Ein gerichtetes Bibliothekskonstruktionsverfahren wurde verwendet, um die einzelsträngige Natur der mRNA zu bewerten. Dies ist eine wichtige Qualitätsmetrik in den Offenlegungsdokumenten von EMA und TGA, da dsRNA (> 0,5 %) No Ribo depletion or PolyA enrichment was performed as to provide the most unbiased assessment of all fragments in the library. The library was amplified for 16 cycles according to the manufacturers protocol. A directional library construction method was used to evaluate the single stranded nature of the mRNA. This is an important quality metric in the EMA and TGA disclosure documents as dsRNA (>0.5%) can eine angeborene induce an innate immune Immunantwort induzieren kann. Der dsRNA-Gehalt wird oft mit einem ELISA bestimmt. Die gerichtete DNA-Sequenzierung bietet eine umfassendere Methode für ihre Schätzung und wurde zuvor in response. dsRNA content is often estimated using an ELISA. Directional DNA sequencing offers a more comprehensive method for its estimation and was previously measured and 99.99% in Jeong et al. mit 99,99 % gemessen. Jeong et al.Es ist unklar, wie dies von Charge zu Charge oder innerhalb des neuen Herstellungsverfahrens für die neueren bivalenten Impfstoffe variieren kann. It is unclear how this may vary lot to lot or within the new manufacturing process for the newer bivalent vaccines.

ErgebnisseResults

Die Fragmentanalyse jedes Fläschchens ist in Abbildung 1 dargestellt. Die RNA-Fragmentierung ist bei beiden Marken und allen Chargen offensichtlich, ist aber bei Pfizer-Fläschchen besonders ausgeprägt. Überraschenderweise wurden auch in den bivalenten Impfstoffen mRNA-Produkte beobachtet, die länger als die erwartete Länge der mRNA waren.Fragment analysis of each vial is depicted in Figure 1. RNA fragmentation is evident in both brands and all lots but is particularly notable in Pfizer vials. Surprisingly, mRNA products longer than the anticipated length of the mRNA were also observed in the bivalent vaccines.

Abbildung 1. Agilent Tape Station Elektrophorese der bivalenten Impfstoffe. mRNA-1273.214 von Moderna (oben) und der bivalente Impfstoff von Pfizer (unten).Figure 1. Agilent Tape Station Electrophoresis of the Bivalent vaccines. Moderna mRNA-1273.214 (Top) and the Pfizer bivalent vaccine (Bottom).

 

Diese längeren Fragmente sind nicht in Patel et al. mit den monovalenten Impfstoffen.These longer fragments are note seen in Patel et al. with the monovalent vaccines.

Patel et al. Elektrophorese des BNT162b2-mRNA-Impfstoffs.Patel et al electrophoresis of the BNT162b2 mRNA vaccine.

 

Der erste Schritt bei der Herstellung von RNA-Seq-Bibliotheken besteht darin, diese mRNAs zu fragmentieren und sie in DNA umzuwandeln.The first step in making RNA-Seq libraries is to fragment these mRNAs and convert them into DNA.

The ‘directional’ library Die Konstruktionsmethode construction method is described here.der „gerichteten“ Bibliothek wird hier beschrieben. Richtungsbibliotheken stellen sicher, dass das Wissen über den Strang (Watson- vs. Crick-Strang) erfasst wird, und als Ergebnis kann man die doppelsträngige DNA- oder RNA-Kontamination in der mRNA-Synthese des Impfstoffs besser abschätzen. Directional libraries ensure that knowledge of the strand (watson vs crick strand) is captured and as a result one can better estimate double-stranded DNA or RNA contamination in the mRNA synthesis of the vaccine.

Der Erststrang-Syntheseschritt kann einen zusätzlichen Fehler basierend auf der Empfindlichkeit der Reversen Transkriptase gegenüber m1Ψ einführen. Die Synthese beginnt mit einer Reversen Transkriptase (RT-Polymerase) und zufälligen Primern (5’NNNNNN-3’OH). Sobald diese zufälligen Primer mit RNA hybridisieren, baut das RT-Enzym Nukleotide ein, die am besten zur Matrize passen. Diese Matrizen haben eine Base, von der bekannt ist, dass sie die Basenpaarungstreue (m1Ψ) stört.The 1st strand synthesis step may introduce additional error based on Reverse Transcriptase sensitivity to m1Ψ. The synthesis begins with a Reverse Transcriptase (RT polymerase) and random primers (5’NNNNNN-3’OH). Once these random primers hybridize to RNA, the RT enzyme incorporates nucleotide that best match the template. These templates have a base known to disrupt base pairing fidelity (m1Ψ).

 

Nach der Synthese des ersten Strangs folgt eine kurzlebige Synthese des zweiten DNA-Strangs, die eine enzymatisch „löschbare“ Base (auf DNA basierendes Uracil) enthält. Dies erleichtert die Ligation von doppelsträngigen Sequenzierungsadaptern an die dsDNA-Moleküle. Nach Adapterligation wird dieser zweite Strang unter Verwendung von UDG/UNG oder einem USER-Enzym von New England BioLabs gelöscht.Following first strand synthesis, there is an ephemeral second DNA strand synthesis that incorporates an enzymatically ‘erase-able’ base (DNA based Uracil). This facilitates the ligation of double stranded sequencing adaptors to the dsDNA molecules. After adaptor ligation, this second strand is erased using UDG/UNG or a USER enzyme from New England BioLabs.

Zu beachten ist, dass dieses USER-Enzym DNA-basierte Uracile verdaut, nicht RNA-basierte Uracile. Als Ergebnis wird nur die Erststrangsynthese als Matrize für die Bibliotheks-PCR verwendet. Da Polymerasefehler auf PCR-Basis um eine Größenordnung weniger häufig sind (1:100.000) als Reverse-Transkriptase-Fehler (1:10.000), sollten wir hauptsächlich Fehler aus der Erststrangsynthese sehen, die versucht, eine m1Ψ-RNA-Matrize zu replizieren. Das Endergebnis dieses Ansatzes wird hauptsächlich zwei Fehlerarten haben.Of note, this USER enzyme digests DNA based uracils, not RNA based uracils. As a result, only the first strand synthesis is used as a template for library PCR. Since PCR based polymerase errors are an order of magnitude less frequent (1:100,000) than Reverse Transcriptase errors (1:10,000), we should see errors predominantly from the 1st strand synthesis attempting to replicate a m1Ψ RNA template. The final result of this approach will have primarily 2 modes of error.

1) T7-RNA-Polymerase wird verwendet, um mRNA-Impfstoffe aus einem DNA-basierten Expressionsvektor zu synthetisieren. T7-RNA-Polymerase wird einen erhöhten Einbaufehler mit m1Ψ aufweisen.1)T7 RNA polymerase is used to synthesize mRNA vaccines from a DNA based expression vector. T7 RNA polymerase will have increased incorporation error with m1Ψ.

2) Reverse-Transcription-Fehler durch Umwandlung der m1Ψ-modifizierten mRNA des Impfstoffs in DNA für die Illumina-Sequenzierung.2)Reverse Transcription error from turning the vaccine m1Ψ modified mRNA into DNA for Illumina sequencing.

Abbildung 2 zeigt die endgültigen Bibliotheksgrößen, die mit diesen Methoden hergestellt wurden. Diese spiegeln nicht den Herstellungsprozess der beiden Impfstoffanbieter wider, sondern sind die erwarteten Ergebnisse eines RNA-Seq-basierten Kits.Figure 2 depicts the final library sizes produced from these methods. These do not reflect on the manufacturing process of either vaccine provider but are the expected results from an RNA-Seq based kit.

Abbildung 2. Illumina-Bibliotheken nach 16 PCR-Zyklen. Die Bibliotheken können wahrscheinlich mit 12 PCR-Zyklen erhalten werden, da die bimodale Verteilung von Amplikons ein Zeichen dafür ist, dass zu viel DNA in die Bibliotheks-PCR eingebracht wird. Das Illumina-Clustering bevorzugt kürzere Amplikons, aber eine höhere Anzahl von falsch gepaarten Reads kann bei bimodaler Amplifikation resultieren.Figure 2. Illumina Libraries after 16 cycles of PCR. The libraries can likely be obtained with 12 cycles of PCR as the bimodal distribution of amplicons is a sign of too much input DNA into the Library PCR. The Illumina clustering will favor shorter amplicons but a higher number of improperly paired reads may result with bimodal amplification.

 

4 Bibliotheken zum Vergleich überlagert4 Libraries overlaid for comparison

AnalysepipelineAnalysis pipeline

Lesevorgänge wurden demultiplext und verarbeitet mitReads were demultiplexed and processed with

  • Trimgalore Trimgalore– Entfernt Illumina-Sequenzierungsadapter. – Removes Illumina Sequencing adaptors.
  • Megahit Megahit– setzt Reads in Contigs zusammen.- assembles reads into contigs.
  • Megahit für SARs-CoV-2Megahit for SARs-CoV-2
  • Samtools Samtools– generiert BAM-Dateien zur Anzeige in IGV.- generates BAM files for viewing in IGV.
  • BWA-mem BWA-mem– Short-Read-Mapper, der verwendet wird, um Reads zurück zu den zusammengestellten Referenzen auszurichten.- Short read mapper used to align reads back to the assembled references.
  • SnapGene-Software – ( SnapGene software- (www.snapgene.com www.snapgene.com) – Wird verwendet, um Expressionsvektoren zu visualisieren und zu kommentieren)- Used to visualize and annotate expression vectors
  • IGV IGV– Integrated Genome Viewer zur Visualisierung von Illumina-Sequenzierungs-Reads.- Integrated Genome Viewer used to visualize Illumina sequencing reads. 

Ergebnisse der SequenzierungSequencing results

Da diese mRNA-Targets so klein sind (4 Kb), können sie mit einem DNA-Barcode versehen werden und passen problemlos in jeden Sequenzierungslauf. Illumina HiSeq 4000-Lanes erzeugen normalerweise Since these mRNA targets are so small (4Kb), they can be DNA barcoded and easily fit into any sequencing run. Illumina HiSeq 4000 lanes usually produce über 300 Mio. 150-bp- over 300M 150bpReads pro Lane. 0,5 % dieser Reads (1,5 Millionen Reads) erzeugen ~225 MB Sequenz über ein 4-KB-Fragment. Die 50.000-fache Abdeckung über ein 4-Kb-Fragment ist ein Fehlerbalken für die aktuelle Sequenzerausgabe und unterstreicht die Erschwinglichkeit der Sequenzierung jeder Charge. Der Listenpreis für 300 Mio. Reads von vielen Sequenzierungs-Servicezentren beträgt ~1300 US-Dollar. Die Sequenzierungskosten für diese Proben betrugen 7 $ pro Fläschchen und es wurde lediglich 1/3 einer Dosis (100 ul) verwendet. Die Baukosten für die Bibliothek haben möglicherweise zusätzliche Kosten in Höhe von 50 USD verursacht. reads per lane. 0.5% of these reads (1.5 million reads) produces ~225Mb of sequence across a 4Kb fragment. 50,000X coverage across a 4Kb fragment is an error bar on current sequencer output, underscoring the affordability of sequencing every lot. The list price for 300M reads from many sequencing service centers is ~$1300. The sequencing costs for these samples was $7 per vial and used a mere 1/3rd of a dose (100ul). The library construction costs may have added an additional $50 in expense.

 

In den bivalenten Impfstoffen von Moderna finden sich zwei unterschiedliche Expressionsvektoren. Zwei verschiedene Chargen wurden sequenziert, und in jeder Charge können unterschiedliche Hintergrundexpressionsplasmide vorhanden sein. Da diese Impfstoffe bivalente Inserts haben, teilt der Assembler die Inserts oft in separate Contigs auf (Omicron vs. Wuhan-1). Ich habe die gesamte Ausgabedatei von Megahit beigefügt, um diese Verweise von der Öffentlichkeit weiter aufpolieren zu lassen. Diese Entwurfsbaugruppen wurden in roher Form direkt von Megahit geliefert, um eine Reproduktion der Arbeit zu ermöglichen.Two different expression vectors are found in the Moderna bivalent vaccines. Two different lots were sequenced and there may different background expression plasmids in each lot. Note, since these vaccines have bivalent inserts, the assembler is often splitting the inserts into separate contigs (omicron vs wuhan-1). I’ve included the entire output file from megahit to afford further polishing of these references by the public. These draft assemblies have been left in raw form delivered directly from megahit to afford reproduction of the work.

Abbildung 3. Bivalentes Moderna-Fläschchen Nr. 2. Dies kann ein leerer Vektor oder ein Assemblierungsartefakt sein, das auftreten kann, wenn das Insert eine 1000-mal höhere Abdeckung aufweist als der Vektor. Beachten Sie, dass die Abdeckung nur 60-fach und andere Vektoren 13.000-fach betragen. Wahrscheinlich ein Index-Hopping-Artefakt.Figure 3. Moderna bivalent vial #2. This may be an empty vector or an assembly artifact that can occur when the insert is 1000X higher in coverage than the vector. Notice the Coverage is only 60X and other vectors are 13,000 X. Likely an index hopping artifact.
> k141_45 Flag = 1 Multi = 60.0000 len=2943CTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAACCTGAGGCTATGGCAGGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAAGAAACGCGGGCGTATTGGCCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAACCCCGCGTTTATGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCAGTTAGCCTCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCGATCTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGCTGGTTCTTTCCGCCTCAGGATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTACGCGTTAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCATGAACAGACTGTGAGGACTGAGGGGCCTGAAATGAGCCTTGGGACTGTGAATCTAAAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAAATTGGATCTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATGTTAAACGGCGGAGCTACCACACCGGTTGGAGCTCTTCTTTTTTT>k141_45 flag=1 multi=60.0000 len=2943 CTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAACCTGAGGCTATGGCAGGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAAGAAACGCGGGCGTATTGGCCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAACCCCGCGTTTATGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCAGTTAGCCTCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCGATCTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCTGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGCTGGTTCTTTCCGCCTCAGGATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTACGCGTTAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCATGAACAGACTGTGAGGACTGAGGGGCCTGAAATGAGCCTTGGGACTGTGAATCTAAAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAAATTGGATCTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATGTTAAACGGCGGAGCTACCACACCGGTTGGAGCTCTTCTTTTTTT
Abbildung 4. Ein Moderna-Vektor mit einem Spike-Einsatz aus demselben Fläschchen Nr. 2 wie in Abbildung 3.Figure 4. A Moderna vector with a spike insert from the same Vial #2 as in figure 3.

 

> k141_73 Flag = 1 Multi = 13386.0482 Länge=6777CTGCAGGCTCTGCAGCCGGCCAGTGATCAGCCGGTCGATCTGCACCTCGGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCGTTCAGCACGCTGCTGATGGCGCCGAACTTGCTGCTCAGCTGCTTCACCAGGGTGTTCAGGGCCTGGGCGTTCTGGTTCACCACGTCCTGCAGCTTGCCCAGGGCGCTAGCGGTGCTGCTCAGGCTGTCCTGGATCTTGCCGATGGCGCTGTTGAACTGGTTGGCGATCAGCTTCTGGTTCTCGTACAGAACGTTCTGGGTCACGCTGATGCCGTTGAACCGGTAGTCGATCTGCATGGCGAAGGTGATCTGCAGAGCGGCTCCAGCGCCGAAAGTCCAGCCGCTGGTGATGGTTCCGGCGAACAGGGCGCTGGTGTACTGGCGATCATCTCGTCGGTCAGCAGGGGAGGCAGCACGGTCAGGCCGTTGAACTTCTGGGCGCAGATCAGGTCCCGGGCGGCTATGTCGCCGAGGCAGTCGCCGTAGCTTGATGAAGCCGGCGTCGGCTAGGGTCACCTTGTTGAACAGCAGGTCCTCGATGAAGCTCCGCTTGCTGGGCTTGCTGGGGTCGGGCAGGATCTGGCTGAAGTTGAAGCCGCCGAAGTCCTTGATGGGAGGGGTCTGGAACTAGCAGAGGTGGTGAGTGGGGCAGGTGGAGGTGGGAGCATACCTGGGACCCGAGGTCGGGGGAGACTCGGGGTACCCAGGACGGGAAAGGGGCAGCTAGCATTGCGTGCATGCAGTACCAGCTCGAGTCATCATGTGTAGTGCAGTTTCACGCCCTTCAGCACGGGCTCAGAATCGTCCTCGTCGAACTTGCAGCAGCTGCCACAGCTACAACAGCCCTTCAGGCAGCTACAGCAGCTGGTCATGCAACACAGCATGATTGTGACCATCACGATGGCAATCAGTCCGGCGATAAAGCCCAGCCAGATGTACCAGGGCCACTTGATGTACTGCTCGTACTTCCCCAGTTCTTGCAGGTCGATCAGGCTCTCGTTCAGATTCTTGGCCACCTCGTTCAGCCGATCGATCTCCTTCTGGATGTTCACCACGCTGGCGTTGATGCCGCTGATGTCGCCCAGGTCCACGTCGGGGCTGGTGTGATTCTTGAAGTACTTGTCCAGCTCCTCCTTGAAGCTGTCCAGCTCGGGCTGCAGGGGATCGTACACGGTGTTGTTCACGATGCCGATCACCACGTCGCAGTTGCCGCTCACGAAGGTGTTGTCGGTGGTGATGATCTGGGGCTCGTAGAAGTTCCGCTGGGTCACGAACCAGTGGGTGCCGTTGCTCACGAACACGCCCTCCCGGGGAAAGTGGGCCTTGCCGTCGTGGCAGATGGCTGGGGCGGTGGTGAAGTTCTTCTCCTGGGCGGGCACGTAGGTCACGTGCAGGAACACCACTCCGTGGGGTGCGCTCTGGGGAAAGCTCATCAGGTGGTAGCCCTTGCCGCAGAAGTCCACCCGCTTGCTCTGGCCCAGCACGCACTCGCTCATCTTGGTGGCGGCCAGGTTGGCGCTGGCCCGAATCTCGGCGGCCCGGATCAGCTGCTGGGTCACGTAGGTCTGCAGGCTCTGCAGCCGGCCAGTGATCAGCCGGTCGATCTGCACCTCGGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCGTTCAGCACGCTGCTGATGGCGCCGAAGTTGCTGCTCAGCTGCTTCACCAGGGTGTTCAGGGCCTGGGCGTTGTGGTTCACCACGTCCTGCAGCTTGCCCAGGGCGCTAGCGGTGCTGCTCAGGCTGTCCTGGATCTTGCCGATGGCGCTGTTGAACTGGTTGGCGATCAGCTTCTGGTTCTCGTACAGCACGTTCTGGGTCACGCCGATGCCGTTGAACCGGTAGGCCATCTGCATGGCGAAGGGGATCTGCAGAGCGGCTCCAGCGCCGAAAGTCCAGCCGCTGGTGATGGTTCCGGCTAACAGGGCGCTGGTGTACTGGGCGATCATCTCGTCGGTCAGCAGGGGAGGCAGCACGGTCAGGCCGTTGAACTTCTGGGCGCAGATCAGGTCCCGGGCGGCTATGTCGCCGAGGCAGTCGCCGTACTGCTTGATGAAGCCGGCGTCGGCTAGGGTCACCTTGTTGAACAGCAGGTCCTCGATGAAGCTCCGCTTGCTGGGCTTGCTGGGGTCGGGCAGGATCTGGCTGAAGTTGAAGCCGCCGAAGTACTTGATGGGAGGGGTCTTGTAGATCTGCTTCACCTGGGCGAACACCTGCTGGGTGTTCTTGTCCTGCTCCACGGCGATGCCGGTCAGGGCCCGGTTCAGCTGGGTGCAGAAGCTGCCGTACTGCAGCAGCAGGTTGCTGCACTCGGTGCTGTCGCCGCAGATGTACATGGTGCAGTCCACGCTGGTCTTGGTCATGCTCACGGGCAGAATCTCGGTGGTCACGCTGATGGTGAAGTTGGTGGGGATGGCGATGCTGTTGTTGCTGTAGGCCACGCTGTTCTCGGCGCCCAGGCTCATGGTGTAGGCGATGATGCTCTGGCTGGCCACGCTCCTTGCCCTCCGGTGTGACTTGGTCTGGGTCTGGTAGCTGGCACAGATGCCGGCGCCGATGGGGATGTCGCACTCGTAGCTGTTGTTCACGTGCTCGGCGCCGATCAGGCAACCGGCCCGGGTCTGGAACACGTTGCTGCCGGTGCTGTAGACCCGCCAGGTGGGTGTCAGCTGGTCGGCGTGGATGGCCACGGGCACCTCGGTGCAGTTCACACCCTGGTACAGCACGGCCACCTGGTTGCTGGTGTTGGTGCCTGGGGTGATCACGCTCACGCCGCCGAAGCTGCAAGGGGTGATGTCCAGGATCTCCAGGGTCTGGGGATCCCGCACAGCGTCGGTGGTGTCGGCGATGTCCCGGCCGAACTGCTGAAAGGGCAGGAATTTCTTGTTGCTCTCGGTCAGCACGCCGGTGCCGGTAAGGCCGTTGAAGTTGAAGTTCACGCACTTGTTCTTCACCAGGTTGGTGCTCTTCTTGGGGCCACACACGGTGGCTGGGGCGTGCAGCAGCTCGAAGCTCAGCACCACCACCCGGTAGGGCTGGTGGCCCACGCCGTAGGTGGGCCGGAAGCCGTAGCTCTGCAGAGGGAAGTAGCAGTTCACGCCGGCCACGCCGTTGCAAGGCTTGTTGCCGGCTTGGTAGATCTCGGTGCTGATGTCCCGCTCGAAGGGCTTCAGGTTGCTCTTCCGGAACAGCCGGTACCGGTAGTTGTAGTTGCCGCCCACCTTGCTGTCGAGCTTGTTGCTGTTCCAGGCGATCACGCAGCCGGTGAAGTCGTCGGGCAGCTTGTAGTTGTAGTCGGCGATGTTGCCTGTCTGGCCGGGTGCGATCTGGCTCACCTCGTTGCCACGGATCACGAAGCTGTCGGCGTACACGTTGGTGAAGCACAGGTCGTTCAGCTTGGTGGGGCTCACGCCGTAGCACTTGAAGGCGAAGAATGGGGCGAAGTTGTACAGCACGCTGTAGTCGGCCACGCAGTTGCTGATCCGCTTCCGGTTCCAGGCGTACACGCTGGCGAACCGGGTGGCGTTGAACACCTCGTCGAAGGGGCACAGGTTGGTGATGTTGGGGAACCGCACGATGCTCTCGGTGGGCTGCACCCGGAAGTTGCTGGTCTGGTAGATGCCCTTCTCCACGGTGAAGCTCTTCAGGGTGCACTTGGTCTCGCTCAGAGGGTCCAGGGCGCAGTCCACGGCGTCGGTGATGGTGCCGTTCTCGTTGTACTTCAGCAGGAAGGTCCGGGGCTGCAGGTAGCCCACGTAGTAAGCAGCCGCGCCTGCTGTCCACCCGCTGCTGCTGTCGCCTGGGGTCAGGTAGCTCCGGTGCAGGGCCAGCAGGGTCTGGAACCGGGTGATGTTGATGCCGATGGGCAGGTCCACCAGGGGCTCCAGGGCTGAGAAGCCCTGGGGCAGATCCCGCACCAGGTTGATTGGGGTGTGCTTGCTGTAGATCTTGAAGTAGCCGTCGATGTTCTTGAACACGAACTCCCGCAGGTTCTTGAAGTTGCCCTGCTTGCCCTCCAGGTCCATCAGGAAGGGCTGGCTCACGTACTCGAAGGTGCAGTTGTTGGCGCTGCTGTACACCCGGAACTCGCTCTCCATCCAGCTCTTGTTGTTCTTGTGGTAGTACACGCCCAGGAAGGGGTCGTTGCAGAACTGGAACTCGCACACCTTGATCACCACGTTGGTGGCGTTATTCACGATCAGCAGGCTCTGGGTCTTGCTGTCCAGGGTGGTGCCGAAGATCCAGCCCCGGATGATGTTGCTCTTCTCGGTGCTGGCGAAGTACACGCCGTCGTTGAAGGGCAGCACGGGGTTGTCGAACCGCTTGGTGCCGTTGGTGCCGCTGATGGCGTGGAACCAGGTCACGTTGCTGAAGAAGGGCAGGAACAGGTCCTGGGTGCTGTGCAGGACGCTGCTCCGGAACACCTTGTCGGGGTAGTAGACGCCCCGGGTGAAGCTGTTGGTGTAGGCTGGTGGCAGCTGGGTCCGGGTGGTCAGGTTCACGCACTGGCTGCTCACCAGGGGCAGCAGCACCAGGAACACGAACATGGTGGCGGCGCCGGGGTCTTATATTTCTTCTTACTCTTCTTTTCTCTCTTATTTCCCTATAGTGAGTCGTATTAGCTTCTGTACGAGGGTCCAAAAGCTTGAGCCGGATCGAATTCGTCGTGACTGGGAAAACCCTGGCGGAAAAGGGGCCCGAGCTTAAGACTGGCCGTCGTTTTACAACACAGAAAGAGTTTGTAGAAACGCAAAAAGGCCATGCGTCAGGGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTCCCTACTCTCGCCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGGCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGACGCGCGCGTAACTCACGTTAAGGGATTTTGGTCATGAGCTTGCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGAATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCTTGTGCAAGACGGAAGACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAGTGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAACGCTGTTTTTCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGTGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAGCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCGTCCATGTTGGAATTTAATCGCGGCCTCGACGTTTCCCGTTGAATATGGCTCATATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCAGTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGCAGTGCGACTAACGGCATGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAACTGTTAAAAGGACAATTACAAACAGGAATCGAGTGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAACGCTGTTTTTCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGTGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAGCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCGTCCATGTTGGAATTTAATCGCGGCCTCGACGTTTCCCGTTGAATATGGCTCATATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCAGTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGCAGTGCGACTAACGGCATGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAACTGTTAAAAGGACAATTACAAACAGGAATCGAGTGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAACGCTGTTTTTCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGTGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAGCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCGTCCATGTTGGAATTTAATCGCGGCCTCGACGTTTCCCGTTGAATATGGCTCATATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCAGTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGCAGTGCGACTAACGGCATGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAACCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAGCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCGTCCATGTTGGAATTTAATCGCGGCCTCGACGTTTCCCGTTGAATATGGCTCATATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCAGTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGCAGTGCGACTAACGGCATGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAACCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAGCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCGTCCATGTTGGAATTTAATCGCGGCCTCGACGTTTCCCGTTGAATATGGCTCATATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCAGTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGCAGTGCGACTAACGGCATGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAAGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAAAGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAAA>k141_73 flag=1 multi=13386.0482 len=6777 CTGCAGGCTCTGCAGCCGGCCAGTGATCAGCCGGTCGATCTGCACCTCGGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCGTTCAGCACGCTGCTGATGGCGCCGAACTTGCTGCTCAGCTGCTTCACCAGGGTGTTCAGGGCCTGGGCGTTCTGGTTCACCACGTCCTGCAGCTTGCCCAGGGCGCTAGCGGTGCTGCTCAGGCTGTCCTGGATCTTGCCGATGGCGCTGTTGAACTGGTTGGCGATCAGCTTCTGGTTCTCGTACAGAACGTTCTGGGTCACGCTGATGCCGTTGAACCGGTAGTCGATCTGCATGGCGAAGGTGATCTGCAGAGCGGCTCCAGCGCCGAAAGTCCAGCCGCTGGTGATGGTTCCGGCGAACAGGGCGCTGGTGTACTGGCGATCATCTCGTCGGTCAGCAGGGGAGGCAGCACGGTCAGGCCGTTGAACTTCTGGGCGCAGATCAGGTCCCGGGCGGCTATGTCGCCGAGGCAGTCGCCGTAGCTTGATGAAGCCGGCGTCGGCTAGGGTCACCTTGTTGAACAGCAGGTCCTCGATGAAGCTCCGCTTGCTGGGCTTGCTGGGGTCGGGCAGGATCTGGCTGAAGTTGAAGCCGCCGAAGTCCTTGATGGGAGGGGTCTGGAACTAGCAGAGGTGGTGAGTGGGGCAGGTGGAGGTGGGAGCATACCTGGGACCCGAGGTCGGGGGAGACTCGGGGTACCCAGGACGGGAAAGGGGCAGCTAGCATTGCGTGCATGCAGTACCAGCTCGAGTCATCATGTGTAGTGCAGTTTCACGCCCTTCAGCACGGGCTCAGAATCGTCCTCGTCGAACTTGCAGCAGCTGCCACAGCTACAACAGCCCTTCAGGCAGCTACAGCAGCTGGTCATGCAACACAGCATGATTGTGACCATCACGATGGCAATCAGTCCGGCGATAAAGCCCAGCCAGATGTACCAGGGCCACTTGATGTACTGCTCGTACTTCCCCAGTTCTTGCAGGTCGATCAGGCTCTCGTTCAGATTCTTGGCCACCTCGTTCAGCCGATCGATCTCCTTCTGGATGTTCACCACGCTGGCGTTGATGCCGCTGATGTCGCCCAGGTCCACGTCGGGGCTGGTGTGATTCTTGAAGTACTTGTCCAGCTCCTCCTTGAAGCTGTCCAGCTCGGGCTGCAGGGGATCGTACACGGTGTTGTTCACGATGCCGATCACCACGTCGCAGTTGCCGCTCACGAAGGTGTTGTCGGTGGTGATGATCTGGGGCTCGTAGAAGTTCCGCTGGGTCACGAACCAGTGGGTGCCGTTGCTCACGAACACGCCCTCCCGGGGAAAGTGGGCCTTGCCGTCGTGGCAGATGGCTGGGGCGGTGGTGAAGTTCTTCTCCTGGGCGGGCACGTAGGTCACGTGCAGGAACACCACTCCGTGGGGTGCGCTCTGGGGAAAGCTCATCAGGTGGTAGCCCTTGCCGCAGAAGTCCACCCGCTTGCTCTGGCCCAGCACGCACTCGCTCATCTTGGTGGCGGCCAGGTTGGCGCTGGCCCGAATCTCGGCGGCCCGGATCAGCTGCTGGGTCACGTAGGTCTGCAGGCTCTGCAGCCGGCCAGTGATCAGCCGGTCGATCTGCACCTCGGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCGTTCAGCACGCTGCTGATGGCGCCGAAGTTGCTGCTCAGCTGCTTCACCAGGGTGTTCAGGGCCTGGGCGTTGTGGTTCACCACGTCCTGCAGCTTGCCCAGGGCGCTAGCGGTGCTGCTCAGGCTGTCCTGGATCTTGCCGATGGCGCTGTTGAACTGGTTGGCGATCAGCTTCTGGTTCTCGTACAGCACGTTCTGGGTCACGCCGATGCCGTTGAACCGGTAGGCCATCTGCATGGCGAAGGGGATCTGCAGAGCGGCTCCAGCGCCGAAAGTCCAGCCGCTGGTGATGGTTCCGGCTAACAGGGCGCTGGTGTACTGGGCGATCATCTCGTCGGTCAGCAGGGGAGGCAGCACGGTCAGGCCGTTGAACTTCTGGGCGCAGATCAGGTCCCGGGCGGCTATGTCGCCGAGGCAGTCGCCGTACTGCTTGATGAAGCCGGCGTCGGCTAGGGTCACCTTGTTGAACAGCAGGTCCTCGATGAAGCTCCGCTTGCTGGGCTTGCTGGGGTCGGGCAGGATCTGGCTGAAGTTGAAGCCGCCGAAGTACTTGATGGGAGGGGTCTTGTAGATCTGCTTCACCTGGGCGAACACCTGCTGGGTGTTCTTGTCCTGCTCCACGGCGATGCCGGTCAGGGCCCGGTTCAGCTGGGTGCAGAAGCTGCCGTACTGCAGCAGCAGGTTGCTGCACTCGGTGCTGTCGCCGCAGATGTACATGGTGCAGTCCACGCTGGTCTTGGTCATGCTCACGGGCAGAATCTCGGTGGTCACGCTGATGGTGAAGTTGGTGGGGATGGCGATGCTGTTGTTGCTGTAGGCCACGCTGTTCTCGGCGCCCAGGCTCATGGTGTAGGCGATGATGCTCTGGCTGGCCACGCTCCTTGCCCTCCGGTGTGACTTGGTCTGGGTCTGGTAGCTGGCACAGATGCCGGCGCCGATGGGGATGTCGCACTCGTAGCTGTTGTTCACGTGCTCGGCGCCGATCAGGCAACCGGCCCGGGTCTGGAACACGTTGCTGCCGGTGCTGTAGACCCGCCAGGTGGGTGTCAGCTGGTCGGCGTGGATGGCCACGGGCACCTCGGTGCAGTTCACACCCTGGTACAGCACGGCCACCTGGTTGCTGGTGTTGGTGCCTGGGGTGATCACGCTCACGCCGCCGAAGCTGCAAGGGGTGATGTCCAGGATCTCCAGGGTCTGGGGATCCCGCACAGCGTCGGTGGTGTCGGCGATGTCCCGGCCGAACTGCTGAAAGGGCAGGAATTTCTTGTTGCTCTCGGTCAGCACGCCGGTGCCGGTAAGGCCGTTGAAGTTGAAGTTCACGCACTTGTTCTTCACCAGGTTGGTGCTCTTCTTGGGGCCACACACGGTGGCTGGGGCGTGCAGCAGCTCGAAGCTCAGCACCACCACCCGGTAGGGCTGGTGGCCCACGCCGTAGGTGGGCCGGAAGCCGTAGCTCTGCAGAGGGAAGTAGCAGTTCACGCCGGCCACGCCGTTGCAAGGCTTGTTGCCGGCTTGGTAGATCTCGGTGCTGATGTCCCGCTCGAAGGGCTTCAGGTTGCTCTTCCGGAACAGCCGGTACCGGTAGTTGTAGTTGCCGCCCACCTTGCTGTCGAGCTTGTTGCTGTTCCAGGCGATCACGCAGCCGGTGAAGTCGTCGGGCAGCTTGTAGTTGTAGTCGGCGATGTTGCCTGTCTGGCCGGGTGCGATCTGGCTCACCTCGTTGCCACGGATCACGAAGCTGTCGGCGTACACGTTGGTGAAGCACAGGTCGTTCAGCTTGGTGGGGCTCACGCCGTAGCACTTGAAGGCGAAGAATGGGGCGAAGTTGTACAGCACGCTGTAGTCGGCCACGCAGTTGCTGATCCGCTTCCGGTTCCAGGCGTACACGCTGGCGAACCGGGTGGCGTTGAACACCTCGTCGAAGGGGCACAGGTTGGTGATGTTGGGGAACCGCACGATGCTCTCGGTGGGCTGCACCCGGAAGTTGCTGGTCTGGTAGATGCCCTTCTCCACGGTGAAGCTCTTCAGGGTGCACTTGGTCTCGCTCAGAGGGTCCAGGGCGCAGTCCACGGCGTCGGTGATGGTGCCGTTCTCGTTGTACTTCAGCAGGAAGGTCCGGGGCTGCAGGTAGCCCACGTAGTAAGCAGCCGCGCCTGCTGTCCACCCGCTGCTGCTGTCGCCTGGGGTCAGGTAGCTCCGGTGCAGGGCCAGCAGGGTCTGGAACCGGGTGATGTTGATGCCGATGGGCAGGTCCACCAGGGGCTCCAGGGCTGAGAAGCCCTGGGGCAGATCCCGCACCAGGTTGATTGGGGTGTGCTTGCTGTAGATCTTGAAGTAGCCGTCGATGTTCTTGAACACGAACTCCCGCAGGTTCTTGAAGTTGCCCTGCTTGCCCTCCAGGTCCATCAGGAAGGGCTGGCTCACGTACTCGAAGGTGCAGTTGTTGGCGCTGCTGTACACCCGGAACTCGCTCTCCATCCAGCTCTTGTTGTTCTTGTGGTAGTACACGCCCAGGAAGGGGTCGTTGCAGAACTGGAACTCGCACACCTTGATCACCACGTTGGTGGCGTTATTCACGATCAGCAGGCTCTGGGTCTTGCTGTCCAGGGTGGTGCCGAAGATCCAGCCCCGGATGATGTTGCTCTTCTCGGTGCTGGCGAAGTACACGCCGTCGTTGAAGGGCAGCACGGGGTTGTCGAACCGCTTGGTGCCGTTGGTGCCGCTGATGGCGTGGAACCAGGTCACGTTGCTGAAGAAGGGCAGGAACAGGTCCTGGGTGCTGTGCAGGACGCTGCTCCGGAACACCTTGTCGGGGTAGTAGACGCCCCGGGTGAAGCTGTTGGTGTAGGCTGGTGGCAGCTGGGTCCGGGTGGTCAGGTTCACGCACTGGCTGCTCACCAGGGGCAGCAGCACCAGGAACACGAACATGGTGGCGGCGCCGGGGTCTTATATTTCTTCTTACTCTTCTTTTCTCTCTTATTTCCCTATAGTGAGTCGTATTAGCTTCTGTACGAGGGTCCAAAAGCTTGAGCCGGATCGAATTCGTCGTGACTGGGAAAACCCTGGCGGAAAAGGGGCCCGAGCTTAAGACTGGCCGTCGTTTTACAACACAGAAAGAGTTTGTAGAAACGCAAAAAGGCCATGCGTCAGGGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTCCCTACTCTCGCCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGGCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGACGCGCGCGTAACTCACGTTAAGGGATTTTGGTCATGAGCTTGCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGAATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCTTGTGCAAGACGGAAGACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAGTGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAACGCTGTTTTTCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGTGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAAGCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCGTCCATGTTGGAATTTAATCGCGGCCTCGACGTTTCCCGTTGAATATGGCTCATATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCAGTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGCAGTGCGACTAACGGCATGAAGCTCGTCGGGGCTGGGTACCGAGCTCGCAAAAA
Abbildung 5. Bivalenter Moderna-Impfstoffvektor aus Fläschchen 1. Dieser weist eine partielle Spike-Sequenz auf. Wahrscheinlich gebrochen aufgrund der Divergenz von Omicron und Wuhan-1.Figure 5. Moderna bivalent vaccine vector from vial 1. This has a partial Spike sequence. Likely broken due to Omicron and Wuhan-1 divergence.

 

> k141_175 Flag = 0 Multi = 24996.5933 Länge=3839AAAAAATATAGACATCCCTTCAGAGTCCCGGGTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCGAGCTCGGTACCCAGCCCCGACGAGCTTCATGCCGTTAGTCGCACTGCAAGGGGTGTTATGAGCCATATTCAGGTATAAATGGGCTCGCGATAATGTTCAGAATTGGTTAATTGGTTGTAACACTGACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAATATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGACGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCACTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCGTTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCACTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTCTTCCGTCTTGCACAAGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATTCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGCGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGCCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGGCGAGAGTAGGGAACTGCCAGGCATCAAACTAAGCAGAAGGCCCCTGACGCATGGCCTTTTTGCGTTTCTACAAACTCTTTCTGTGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCTTTTCCGCCAGGGTTTTCCCAGTCACGACGAATTCGATCCGGCTCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGCCAGTGCGTGAACCTGATCACCCGGACCCAGAGCTACACCAACAGCTTCACCCGGGGCGTCTACTACCCCGACAAGGTGTTCCGGAGCAGCGTCCTGCACAGCACCCAGGACCTGTTCCTGCCCTTCTTCAGCAACGTGACCTGGTTCCACGCCATCAGCGGCACCAACGGCACCAAGCGGTTCGACAACCCCGTGCTGCCCTTCAACGACGGCGTGTACTTCGCCAGCACCGAGAAGAGCAACATCATCCGGGGCTGGATCTTCGGCACCACCCTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAATAACGCCACCAACGTGGTGATCAAGGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTGTACTACCACAAGAACAACAAGAGCTGGATGGAGAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGAGCCAGCCCTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGCGGGAGTTCGTGTTCAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCAATCAACCTGGTGCGGGATCTGCCCCAGGGCTTCTCAGCCCTGGAGCCCCTGGTGGACCTGCCCATCGGCATCAACATCACCCGGTTCCAGACCCTGCTGGCCCTGCACCGGAGCTACCTGACCCCAGGCGACAGCAGCAGCGGGTGGACAGCAGGCGCGGCTGCTTACTACGTGGGCTACCTGCAGCCCCGGACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCAAGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACCCGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCAACGAGGTGAGCCAGATCGCACCCGGCCAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAAGCTCGACAGCAAGGTGGGCGGCAACTACATCTACCGGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGGACATCAGCACCGAGATCTACCAAGCCGGCAACAAGCCTTGCAACGGCGTGGCCGGCGTGAACTGCTACTTCCCTCTGCAGAGCTACGGCTTCCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCCAAGAAGAGCACCAACCTG>k141_175 flag=0 multi=24996.5933 len=3839 AAAAAATATAGACATCCCTTCAGAGTCCCGGGTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCGAGCTCGGTACCCAGCCCCGACGAGCTTCATGCCGTTAGTCGCACTGCAAGGGGTGTTATGAGCCATATTCAGGTATAAATGGGCTCGCGATAATGTTCAGAATTGGTTAATTGGTTGTAACACTGACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAATATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGACGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCACTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGCGTTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCACTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTCTTCCGTCTTGCACAAGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATTCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGCGCGTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGCCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGGCGAGAGTAGGGAACTGCCAGGCATCAAACTAAGCAGAAGGCCCCTGACGCATGGCCTTTTTGCGTTTCTACAAACTCTTTCTGTGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCTTTTCCGCCAGGGTTTTCCCAGTCACGACGAATTCGATCCGGCTCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGCCAGTGCGTGAACCTGATCACCCGGACCCAGAGCTACACCAACAGCTTCACCCGGGGCGTCTACTACCCCGACAAGGTGTTCCGGAGCAGCGTCCTGCACAGCACCCAGGACCTGTTCCTGCCCTTCTTCAGCAACGTGACCTGGTTCCACGCCATCAGCGGCACCAACGGCACCAAGCGGTTCGACAACCCCGTGCTGCCCTTCAACGACGGCGTGTACTTCGCCAGCACCGAGAAGAGCAACATCATCCGGGGCTGGATCTTCGGCACCACCCTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAATAACGCCACCAACGTGGTGATCAAGGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGGCGTGTACTACCACAAGAACAACAAGAGCTGGATGGAGAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGAGCCAGCCCTTCCTGATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGCGGGAGTTCGTGTTCAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCAATCAACCTGGTGCGGGATCTGCCCCAGGGCTTCTCAGCCCTGGAGCCCCTGGTGGACCTGCCCATCGGCATCAACATCACCCGGTTCCAGACCCTGCTGGCCCTGCACCGGAGCTACCTGACCCCAGGCGACAGCAGCAGCGGGTGGACAGCAGGCGCGGCTGCTTACTACGTGGGCTACCTGCAGCCCCGGACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCAAGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACCCGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCAACGAGGTGAGCCAGATCGCACCCGGCCAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAAGCTCGACAGCAAGGTGGGCGGCAACTACATCTACCGGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGGACATCAGCACCGAGATCTACCAAGCCGGCAACAAGCCTTGCAACGGCGTGGCCGGCGTGAACTGCTACTTCCCTCTGCAGAGCTACGGCTTCCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCCAAGAAGAGCACCAACCTG

 

Expressionsvektor im bivalenten Impfstoff von Pfizer gefundenExpression vector found in the Pfizer bivalent vaccine

Abbildung 6. Zweiwertiger Impfstoffvektor von Pfizer mit SEB/FCS-Anmerkung.Figure 6. Pfizer bivalent vaccine vector with SEB/FCS annotated.

 

> k141_58 Flag = 1 Multi = 11090.9518 Länge = 7479GAGGTGGTGAGTGGGGCAGGTGGAGGTGGGAGCATACCTGGGACCCGAGGTCGGGGGAGACTCGGGGTACCCAGGACGGGAAAGGGGCAGCTAGCATTGCGTGCATGCAGTACCAGCTCGAGTCATCATGTGTAGTGCAGCTTCACGCCCTTCAGCACGGGCTCGCTGTCGTCCTCGTCGAACTTGCAGCAGCTGCCGCAGCTGCAACAGCCCTTCAGGCAGCTGCAGCAGCTGGTCATGCAGCACAGCATGATGGTCACCATCACGATGGCGATCAGGCCGGCGATGAAGCCCAGCCAGATGTACCAGGGCCACTTGATGTACTGCTCGTACTTGCCCAGCTCCTGCAGGTCGATCAGGCTCTCGTTCAGGTTCTTGGCCACCTCGTTCAGCCGATCGATCTCCTTCTGGATGTTCACCACGCTGGCGTTGATGCCGCTGATGTCGCCCAGGTCCACGTCGGGGCTGGTGTGATTCTTGAAGTACTTGTCCAGCTCCTCCTTGAAGCTGTCCAGCTCGGGCTGCAGGGGATCGTACACGGTGTTGTTCACGATGCCGATCACCACGTCGCAGTTGCCGCTCACGAAGGTGTTGTCGGTGGTGATGATCTGGGGCTCGTAGAAGTTCCGCTGGGTCACGAACCAGTGGGTGCCGTTGCTCACGAACACGCCCTCCCGGGGAAAGTGGGCCTTGCCGTCGTGGCAGATGGCTGGGGCGGTGGTGAAGTTCTTCTCCTGGGCGGGCACGTAGGTCACGTGCAGGAACACCACTCCGTGGGGTGCGCTCTGGGGAAAGCTCATCAGGTGGTAGCCCTTGCCGCAGAAGCCCACCCGCTTGCTCTGGCCCAGCACGCACTCGCTCATCTTGGTGGCGGCCAGGTTGGCGCTGGCCCGAATCTCGGCGGCCCGGATCAGCTGCTGGGTCACGTAGGTCTGCAGGCTCTGCAGCCGGCCAGTGATCAGCCGGTCGATCTGCACCTCGGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCGTTCAGCACGCTGCTGATGGCGCCGAACTTGCTGCTCAGCTGCTTCACCAGGGTGTTCAGGGCCTGGGCGTTGTGGTTCACCACGTCCTGCAGCTTGCCCAGGGCGCTAGCGGTGCTGCTCAGGCTGTCCTGGATCTTGCCGATGGCGCTGTTGAACTGGTTGGCGATCAGCTTCTGGTTCTCGTACAGCACGTTCTGGGTCACGCCGATGCCGTTGAACCGGTAGGCCATCTGCATGGCGAAGGGGATCTGCAGAGCGGCTCCAGCGCCGAAAGTCCAGCCGCTGGTGATGGTTCCGGCTAACAGGGCGCTGGTGTACTGGGCGATCATCTCGTCGGTCAGCAGGGGAGGCAGCACGGTCAGGCCGTTGAACTTCTGGGCGCAGATCAGGTCCCGGGCGGCTATGTCGCCGAGGCAGTCGCCGTACTGCTTGATGAAGCCGGCGTCGGCTAGGGTCACCTTGTTGAACAGCAGGTCCTCGATGAAGCTCCGCTTGCTGGGCTTGCTGGGGTCGGGCAGGATCTGGCTGAAGTTGAAGCCGCCGAAGTCCTTGATGGGAGGGGTCTTGTAGATCTGCTTCACCTGGGCGAACACCTCCTGGGTGTTCTTGTCCTGCTCCACGGCGATGCCGGTCAGGGCCCGGTTCAGCTGGGTGCAGAAGCTGCCGTACTGCAGCAGCAGGTTGCTGCACTCGGTGCTGTCGCCGCAGATGTACATGGTGCAGTCCACGCTGGTCTTGGTCATGCTCACGGGCAGAATCTCGGTGGTCACGCTGATGGTGAAGTTGGTGGGGATGGCGATGCTGTTGTTGCTGTAGGCCACGCTGTTCTCGGCGCCCAGGCTCATGGTGTAGGCGATGATGCTCTGGCTGGCCACGCTCCTTGCCCTCCGGGGTGAATTGGTCTGGGTCTGGTAGCTGGCACAGATGCCGGCGCCGATGGGGATGTCGCACTCGTAGCTGTTGTTCACGTGCTCGGCGCCGATCAGGCAACCGGCCCGGGTCTGGAACACGTTGCTGCCGGTGCTGTAGACCCGCCAGGTGGGTGTCAGCTGGTCGGCGTGGATGGCCACGGGCACCTCGGTGCAGTTCACACCCTGGTACAGCACGGCCACCTGGTTGCTGGTGTTGGTGCCTGGGGTGATCACGCTCACGCCGCCGAAGCTGCAAGGGGTGATGTCCAGGATCTCCAGGGTCTGGGGATCCCGCACAGCGTCGGTGGTGTCGGCGATGTCCCGGCCGAACTGCTGAAAGGGCAGGAATTTCTTGTTGCTCTCGGTCAGCACGCCGGTGCCGGTAAGGCCGTTGAAGTTGAAGTTCACGCACTTGTTCTTCACCAGGTTGGTGCTCTTCTTGGGGCCACACACGGTGGCTGGGGCGTGCAGCAGCTCGAAGCTCAGCACCACCACCCGGTAGGGCTGGTGGCCCACGCCGTAGGTGGGCCGGAAGCCGTAGCTCTGCAGAGGGAAGTAGCAGTTCACGCCGGCCACGCCGTTGCAAGGCTTGTTGCCGGCTTGGTAGATCTCGGTGCTGATGTCCCGCTCGAAGGGCTTCAGGTTGCTCTTCCGGAACAGCCGGTACCGGTAGTTGTAGTTGCCGCCCACCTTGCTGTCGAGCTTGTTGCTGTTCCAGGCGATCACGCAGCCGGTGAAGTCGTCGGGCAGCTTGTAGTTGTAGTCGGCGATGTTGCCTGTCTGGCCGGGTGCGATCTGGCTCACCTCGTTGCCACGGATCACGAAGCTGTCGGCGTACACGTTGGTGAAGCACAGGTCGTTCAGCTTGGTGGGGCTCACGCCGTAGCACTTGAAGGCGAAGAATGGGGCGAAGTTGTACAGCACGCTGTAGTCGGCCACGCAGTTGCTGATCCGCTTCCGGTTCCAGGCGTACACGCTGGCGAACCGGGTGGCGTTGAACACCTCGTCGAAGGGGCACAGGTTGGTGATATTGGGGAACCGCACGATGGATTCGGTGGGCTGCACCCGGAAGTTGCTGGTCTGGTAGATGCCCTTTTCCACGGTGAAGGACTTCAGGGTGCACTTTGTCTCGCTCAGAGGATCCAGAGCACAATCCACGGCGTCGGTGATGGTGCCGTTCTCGTTGTACTTCAGCAGGAAGGTTCTAGGCTGCAGGTAGCCCACATAGTAAGCGGCGGCACCAGCTGTCCATCCGCTGCTGCTATCGCCAGGTGTCAGGTAGCTTCTGTGCAGGGCCAGCAGTGTCTGAAACCGGGTGATGTTGATGCCGATGGGCAGATCCACCAGGGGTTCCAGAGCAGAGAAGCCCTGAGGCAGATCCCGCACGAGGTTGATAGGGGTGTGCTTGCTGTAGATCTTGAAGTAGCCGTCGATGTTCTTAAACACGAACTCGCGCAGGTTCTTGAAGTTGCCCTGCTTGCCTTCCAGGTCCATCAGGAAAGGCTGGGACACGTACTCGAAGGTGCAGTTGTTGGCGCTGCTGTACACCCGGAACTCGCTTTCCATCCAGCTCTTGTTGTTCTTGTGGTAGTAGACGCCCAGGAAGGGGTCGTTGCAGAACTGGAACTCGCACACTTTGATGACCACGTTGGTGGCGTTGTTCACGATCAGCAGGCTCTGGGTCTTGCTGTCCAGTGTGGTGCCGAAGATCCAGCCTCTGATGATGTTGGACTTCTCGGTGCTGGCAAAGTACACCCCGTCGTTGAAGGGCAGCACGGGGTTGTCGAATCTCTTGGTGCCATTGGTGCCGGAGATGGCGTGGAACCAGGTCACGTTGCTGAAGAAAGGCAGGAACAGGTCCTGGGTAGAGTGCAGCACGCTGGATCTGAACACCTTGTCGGGGTAGTACACGCCTCTGGTAAAGCTGTTGGTGTAGGCTGGAGGCAGCTGTGTTCTGGTGGTCAGGTTCACACACTGGCTGGACACCAGAGGCAGCAGCACCAGGAACACGAACATGGTGGCGGGTTCTCTCTGAGTCTGTGGGGACCAGAAGAATACTAGTTTATTCTTATAGTGAGTCGTATTAATTAATAACTAATGCATGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAACCTGAGGCTATGGCAGGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAAGAAACGCGGGCGTATTGGCCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAACCCCGCGTTTATGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCAGTTAGCCTCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCGATCTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGCTGGTTCTTTCCGCCTCAGGATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTACGCGTTAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCATGAACAGACTGTGAGGACTGAGGGGCCTGAAATGAGCCTTGGGACTGTGAATCTAAAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAAATTGGATCTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATGTTAAACGGCGGAGCTACCACACCGGTTGGAGCTCTTCTTTTTTTTTTTTTTTTTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCATGAACAGACTGTGAGGACTGAGGGGCCTGAAATGAGCCTTGGGACTGTGAATCTAAAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAAATTGGATCTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATGTTAAACGGCGGAGCTACCACACCGGTTGGAGCTCTTCTTTTTTTTTTTTTTTTTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCATGAACAGACTGTGAGGACTGAGGGGCCTGAAATGAGCCTTGGGACTGTGAATCTAAAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAAATTGGATCTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATGTTAAACGGCGGAGCTACCACACCGGTTGGAGCTCTTCTTTTTTTTTTTTTTTT>k141_58 flag=1 multi=11090.9518 len=7479 GAGGTGGTGAGTGGGGCAGGTGGAGGTGGGAGCATACCTGGGACCCGAGGTCGGGGGAGACTCGGGGTACCCAGGACGGGAAAGGGGCAGCTAGCATTGCGTGCATGCAGTACCAGCTCGAGTCATCATGTGTAGTGCAGCTTCACGCCCTTCAGCACGGGCTCGCTGTCGTCCTCGTCGAACTTGCAGCAGCTGCCGCAGCTGCAACAGCCCTTCAGGCAGCTGCAGCAGCTGGTCATGCAGCACAGCATGATGGTCACCATCACGATGGCGATCAGGCCGGCGATGAAGCCCAGCCAGATGTACCAGGGCCACTTGATGTACTGCTCGTACTTGCCCAGCTCCTGCAGGTCGATCAGGCTCTCGTTCAGGTTCTTGGCCACCTCGTTCAGCCGATCGATCTCCTTCTGGATGTTCACCACGCTGGCGTTGATGCCGCTGATGTCGCCCAGGTCCACGTCGGGGCTGGTGTGATTCTTGAAGTACTTGTCCAGCTCCTCCTTGAAGCTGTCCAGCTCGGGCTGCAGGGGATCGTACACGGTGTTGTTCACGATGCCGATCACCACGTCGCAGTTGCCGCTCACGAAGGTGTTGTCGGTGGTGATGATCTGGGGCTCGTAGAAGTTCCGCTGGGTCACGAACCAGTGGGTGCCGTTGCTCACGAACACGCCCTCCCGGGGAAAGTGGGCCTTGCCGTCGTGGCAGATGGCTGGGGCGGTGGTGAAGTTCTTCTCCTGGGCGGGCACGTAGGTCACGTGCAGGAACACCACTCCGTGGGGTGCGCTCTGGGGAAAGCTCATCAGGTGGTAGCCCTTGCCGCAGAAGCCCACCCGCTTGCTCTGGCCCAGCACGCACTCGCTCATCTTGGTGGCGGCCAGGTTGGCGCTGGCCCGAATCTCGGCGGCCCGGATCAGCTGCTGGGTCACGTAGGTCTGCAGGCTCTGCAGCCGGCCAGTGATCAGCCGGTCGATCTGCACCTCGGCCTCGGGAGGGTCCAGCCGGCTCAGGATGTCGTTCAGCACGCTGCTGATGGCGCCGAACTTGCTGCTCAGCTGCTTCACCAGGGTGTTCAGGGCCTGGGCGTTGTGGTTCACCACGTCCTGCAGCTTGCCCAGGGCGCTAGCGGTGCTGCTCAGGCTGTCCTGGATCTTGCCGATGGCGCTGTTGAACTGGTTGGCGATCAGCTTCTGGTTCTCGTACAGCACGTTCTGGGTCACGCCGATGCCGTTGAACCGGTAGGCCATCTGCATGGCGAAGGGGATCTGCAGAGCGGCTCCAGCGCCGAAAGTCCAGCCGCTGGTGATGGTTCCGGCTAACAGGGCGCTGGTGTACTGGGCGATCATCTCGTCGGTCAGCAGGGGAGGCAGCACGGTCAGGCCGTTGAACTTCTGGGCGCAGATCAGGTCCCGGGCGGCTATGTCGCCGAGGCAGTCGCCGTACTGCTTGATGAAGCCGGCGTCGGCTAGGGTCACCTTGTTGAACAGCAGGTCCTCGATGAAGCTCCGCTTGCTGGGCTTGCTGGGGTCGGGCAGGATCTGGCTGAAGTTGAAGCCGCCGAAGTCCTTGATGGGAGGGGTCTTGTAGATCTGCTTCACCTGGGCGAACACCTCCTGGGTGTTCTTGTCCTGCTCCACGGCGATGCCGGTCAGGGCCCGGTTCAGCTGGGTGCAGAAGCTGCCGTACTGCAGCAGCAGGTTGCTGCACTCGGTGCTGTCGCCGCAGATGTACATGGTGCAGTCCACGCTGGTCTTGGTCATGCTCACGGGCAGAATCTCGGTGGTCACGCTGATGGTGAAGTTGGTGGGGATGGCGATGCTGTTGTTGCTGTAGGCCACGCTGTTCTCGGCGCCCAGGCTCATGGTGTAGGCGATGATGCTCTGGCTGGCCACGCTCCTTGCCCTCCGGGGTGAATTGGTCTGGGTCTGGTAGCTGGCACAGATGCCGGCGCCGATGGGGATGTCGCACTCGTAGCTGTTGTTCACGTGCTCGGCGCCGATCAGGCAACCGGCCCGGGTCTGGAACACGTTGCTGCCGGTGCTGTAGACCCGCCAGGTGGGTGTCAGCTGGTCGGCGTGGATGGCCACGGGCACCTCGGTGCAGTTCACACCCTGGTACAGCACGGCCACCTGGTTGCTGGTGTTGGTGCCTGGGGTGATCACGCTCACGCCGCCGAAGCTGCAAGGGGTGATGTCCAGGATCTCCAGGGTCTGGGGATCCCGCACAGCGTCGGTGGTGTCGGCGATGTCCCGGCCGAACTGCTGAAAGGGCAGGAATTTCTTGTTGCTCTCGGTCAGCACGCCGGTGCCGGTAAGGCCGTTGAAGTTGAAGTTCACGCACTTGTTCTTCACCAGGTTGGTGCTCTTCTTGGGGCCACACACGGTGGCTGGGGCGTGCAGCAGCTCGAAGCTCAGCACCACCACCCGGTAGGGCTGGTGGCCCACGCCGTAGGTGGGCCGGAAGCCGTAGCTCTGCAGAGGGAAGTAGCAGTTCACGCCGGCCACGCCGTTGCAAGGCTTGTTGCCGGCTTGGTAGATCTCGGTGCTGATGTCCCGCTCGAAGGGCTTCAGGTTGCTCTTCCGGAACAGCCGGTACCGGTAGTTGTAGTTGCCGCCCACCTTGCTGTCGAGCTTGTTGCTGTTCCAGGCGATCACGCAGCCGGTGAAGTCGTCGGGCAGCTTGTAGTTGTAGTCGGCGATGTTGCCTGTCTGGCCGGGTGCGATCTGGCTCACCTCGTTGCCACGGATCACGAAGCTGTCGGCGTACACGTTGGTGAAGCACAGGTCGTTCAGCTTGGTGGGGCTCACGCCGTAGCACTTGAAGGCGAAGAATGGGGCGAAGTTGTACAGCACGCTGTAGTCGGCCACGCAGTTGCTGATCCGCTTCCGGTTCCAGGCGTACACGCTGGCGAACCGGGTGGCGTTGAACACCTCGTCGAAGGGGCACAGGTTGGTGATATTGGGGAACCGCACGATGGATTCGGTGGGCTGCACCCGGAAGTTGCTGGTCTGGTAGATGCCCTTTTCCACGGTGAAGGACTTCAGGGTGCACTTTGTCTCGCTCAGAGGATCCAGAGCACAATCCACGGCGTCGGTGATGGTGCCGTTCTCGTTGTACTTCAGCAGGAAGGTTCTAGGCTGCAGGTAGCCCACATAGTAAGCGGCGGCACCAGCTGTCCATCCGCTGCTGCTATCGCCAGGTGTCAGGTAGCTTCTGTGCAGGGCCAGCAGTGTCTGAAACCGGGTGATGTTGATGCCGATGGGCAGATCCACCAGGGGTTCCAGAGCAGAGAAGCCCTGAGGCAGATCCCGCACGAGGTTGATAGGGGTGTGCTTGCTGTAGATCTTGAAGTAGCCGTCGATGTTCTTAAACACGAACTCGCGCAGGTTCTTGAAGTTGCCCTGCTTGCCTTCCAGGTCCATCAGGAAAGGCTGGGACACGTACTCGAAGGTGCAGTTGTTGGCGCTGCTGTACACCCGGAACTCGCTTTCCATCCAGCTCTTGTTGTTCTTGTGGTAGTAGACGCCCAGGAAGGGGTCGTTGCAGAACTGGAACTCGCACACTTTGATGACCACGTTGGTGGCGTTGTTCACGATCAGCAGGCTCTGGGTCTTGCTGTCCAGTGTGGTGCCGAAGATCCAGCCTCTGATGATGTTGGACTTCTCGGTGCTGGCAAAGTACACCCCGTCGTTGAAGGGCAGCACGGGGTTGTCGAATCTCTTGGTGCCATTGGTGCCGGAGATGGCGTGGAACCAGGTCACGTTGCTGAAGAAAGGCAGGAACAGGTCCTGGGTAGAGTGCAGCACGCTGGATCTGAACACCTTGTCGGGGTAGTACACGCCTCTGGTAAAGCTGTTGGTGTAGGCTGGAGGCAGCTGTGTTCTGGTGGTCAGGTTCACACACTGGCTGGACACCAGAGGCAGCAGCACCAGGAACACGAACATGGTGGCGGGTTCTCTCTGAGTCTGTGGGGACCAGAAGAATACTAGTTTATTCTTATAGTGAGTCGTATTAATTAATAACTAATGCATGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAACCTGAGGCTATGGCAGGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAAGAAACGCGGGCGTATTGGCCCCAATGGGGTCTCGGTGGGGTATCGACAGAGTGCCAGCCCTGGGACCGAACCCCGCGTTTATGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGTCATAGCGCGGGTTCCTTCCGGTATTGTCTCCTTCCGTGTTTCAGTTAGCCTCCCCCTAGGGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGTTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCTCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGTTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCTTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTTGATCGATCTTTGCAAAAGCCTAGGCCTCCAAAAAAGCCTCCTCACTACTTCTGGAATAGCTCAGAGGCCGAGGCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGGGGCGGAGAATGGGCGGAACTGGGCGGAGTTAGGGGCGGGATGGGCGGAGTTAGGGGCGGGACTATGGTTGCTGACTAATTGAGATGCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGCTGGTTCTTTCCGCCTCAGGATTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTACGCGTTAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCATGAACAGACTGTGAGGACTGAGGGGCCTGAAATGAGCCTTGGGACTGTGAATCTAAAATACACAAACAATTAGAATCAGTAGTTTAACACATTATACACTTAAAAATTGGATCTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATGTTAAACGGCGGAGCTACCACACCGGTTGGAGCTCTTCTTTTTTTTTTTTTTTT

 

Abbildung 7. Diese Anordnung spaltete das Spike-Protein, wahrscheinlich aufgrund der Divergenz von Omicron und Wuhan-1s. Als Ergebnis sind 702 bp des Spike-Proteins an den Enden des Moleküls an der Mittags-Hash-Marke dupliziert.Figure 7. This assembly split the spike protein likely due to omicron and Wuhan-1s divergence. As a result there is 702bp of spike protein duplicated on the ends of the molecule at the noon hash mark.

 

> k141_4 Flag = 0 Multi = 20285.8167 Länge=8652GGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGAGGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTAACTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCACGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACCCGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCGACGAGGTGCGGCAGATCGCACCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAACCTCGACAGCAAGGTGGGCGGCAACTACAACTACCTGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGGACATCAGCACCGAGATCTACCAAGCCGGCTCCACCCCTTGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCCTCTGCAGAGCTACGGCTTCCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCCAAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAACGGCCTTACCGGCACCGGCGTGCTGACCGAGAGCAACAAGAAATTCCTGCCCTTTCAGCAGTTCGGCCGGGACATCGCCGACACCACCGACGCTGTGCGGGATCCCCAGACCCTGGAGATCCTGGACATCACCCCTTGCAGCTTCGGCGGCGTGAGCGTGATCACCCCAGGCACCAACACCAGCAACCAGGTGGCCGTGCTGTACCAGGGTGTGAACTGCACCGAGGTGCCCGTGGCCATCCACGCCGACCAGCTGACACCCACCTGGCGGGTCTACAGCACCGGCAGCAACGTGTTCCAGACCCGGGCCGGTTGCCTGATCGGCGCCGAGCACGTGAACAACAGCTACGAGTGCGACATCCCCATCGGCGCCGGCATCTGTGCCAGCTACCAGACCCAGACCAATTCACCCCGGAGGGCAAGGAGCGTGGCCAGCCAGAGCATCATCGCCTACACCATGAGCCTGGGCGCCGAGAACAGCGTGGCCTACAGCAACAACAGCATCGCCATCCCCACCAACTTCACCATCAGCGTGACCACCGAGATTCTGCCCGTGAGCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGACAGCACCGAGTGCAGCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAACCGGGCCCTGACCGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACCCCTCCCATCAAGGACTTCGGCGGCTTCAACTTCAGCCAGATCCTGCCCGACCCCAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAGGTGACCCTAGCCGACGCCGGCTTCATCAAGCAGTACGGCGACTGCCTCGGCGACATAGCCGCCCGGGACCTGATCTGCGCCCAGAAGTTCAACGGCCTGACCGTGCTGCCTCCCCTGCTGACCGACGAGATGATCGCCCAGTACACCAGCGCCCTGTTAGCCGGAACCATCACCAGCGGCTGGACTTTCGGCGCTGGAGCCGCTCTGCAGATCCCCTTCGCCATGCAGATGGCCTACCGGTTCAACGGCATCGGCGTGACCCAGAACGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACCGCTAGCGCCCTGGGCAAGCTGCAGGACGTGGTGAACCAGAACGCCCAGGCCCTGAACACCCTGGTGAAGCAGCTGAGCAGCAACTTCGGCGCCATCAGCAGCGTGCTGAACGACATCCTGAGCCGGCTGGACCCTCCCGAGGCCGAGGTGCAGATCGACCGGCTGATCACTGGCCGGCTGCAGAGCCTGCAGACCTACGTGACCCAGCAGCTGATCCGGGCCGCCGAGATTCGGGCCAGCGCCAACCTGGCCGCCACCAAGATGAGCGAGTGCGTGCTGGGCCAGAGCAAGCGGGTGGACTTCTGCGGCAAGGGCTACCACCTGATGAGCTTTCCCCAGAGCGCACCCCACGGAGTGGTGTTCCTGCACGTGACCTACGTGCCCGCCCAGGAGAAGAACTTCACCACCGCCCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCAAAAAAAAAAAAAGAAGAGCTCCAACCGGTGTGGTAGCTCCGCCGTTTAACATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGAGATCCAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAACGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAATCCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAACATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATTAATACGACTCACTATAAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACAAGAACACAGCTGCCTCCAGCCTACACCAACAGCGTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCATGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCTGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCCTG>k141_4 flag=0 multi=20285.8167 len=8652 GGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGAGGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTAACTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGACTGCGCCCTGGACCCTCTGAGCGAGACCACGTGCACCCTGAAGAGCTTCACCGTGGAGAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAGAGCATCGTGCGGTTCCCCAACATCACCAACCTGTGCCCCTTCGGCGAGGTGTTCAACGCCACCCGGTTCGCCAGCGTGTACGCCTGGAACCGGAAGCGGATCAGCAACTGCGTGGCCGACTACAGCGTGCTGTACAACAGCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGAGCCCCACCAAGCTGAACGACCTGTGCTTCACCAACGTGTACGCCGACAGCTTCGTGATCCGTGGCGACGAGGTGCGGCAGATCGCACCCGGCCAGACAGGCAAGATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGCGTGATCGCCTGGAACAGCAACAACCTCGACAGCAAGGTGGGCGGCAACTACAACTACCTGTACCGGCTGTTCCGGAAGAGCAACCTGAAGCCCTTCGAGCGGGACATCAGCACCGAGATCTACCAAGCCGGCTCCACCCCTTGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCCTCTGCAGAGCTACGGCTTCCAGCCCACCAACGGCGTGGGCTACCAGCCCTACCGGGTGGTGGTGCTGAGCTTCGAGCTGCTGCACGCCCCAGCCACCGTGTGTGGCCCCAAGAAGAGCACCAACCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAACGGCCTTACCGGCACCGGCGTGCTGACCGAGAGCAACAAGAAATTCCTGCCCTTTCAGCAGTTCGGCCGGGACATCGCCGACACCACCGACGCTGTGCGGGATCCCCAGACCCTGGAGATCCTGGACATCACCCCTTGCAGCTTCGGCGGCGTGAGCGTGATCACCCCAGGCACCAACACCAGCAACCAGGTGGCCGTGCTGTACCAGGGTGTGAACTGCACCGAGGTGCCCGTGGCCATCCACGCCGACCAGCTGACACCCACCTGGCGGGTCTACAGCACCGGCAGCAACGTGTTCCAGACCCGGGCCGGTTGCCTGATCGGCGCCGAGCACGTGAACAACAGCTACGAGTGCGACATCCCCATCGGCGCCGGCATCTGTGCCAGCTACCAGACCCAGACCAATTCACCCCGGAGGGCAAGGAGCGTGGCCAGCCAGAGCATCATCGCCTACACCATGAGCCTGGGCGCCGAGAACAGCGTGGCCTACAGCAACAACAGCATCGCCATCCCCACCAACTTCACCATCAGCGTGACCACCGAGATTCTGCCCGTGAGCATGACCAAGACCAGCGTGGACTGCACCATGTACATCTGCGGCGACAGCACCGAGTGCAGCAACCTGCTGCTGCAGTACGGCAGCTTCTGCACCCAGCTGAACCGGGCCCTGACCGGCATCGCCGTGGAGCAGGACAAGAACACCCAGGAGGTGTTCGCCCAGGTGAAGCAGATCTACAAGACCCCTCCCATCAAGGACTTCGGCGGCTTCAACTTCAGCCAGATCCTGCCCGACCCCAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGACCTGCTGTTCAACAAGGTGACCCTAGCCGACGCCGGCTTCATCAAGCAGTACGGCGACTGCCTCGGCGACATAGCCGCCCGGGACCTGATCTGCGCCCAGAAGTTCAACGGCCTGACCGTGCTGCCTCCCCTGCTGACCGACGAGATGATCGCCCAGTACACCAGCGCCCTGTTAGCCGGAACCATCACCAGCGGCTGGACTTTCGGCGCTGGAGCCGCTCTGCAGATCCCCTTCGCCATGCAGATGGCCTACCGGTTCAACGGCATCGGCGTGACCCAGAACGTGCTGTACGAGAACCAGAAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGCACCGCTAGCGCCCTGGGCAAGCTGCAGGACGTGGTGAACCAGAACGCCCAGGCCCTGAACACCCTGGTGAAGCAGCTGAGCAGCAACTTCGGCGCCATCAGCAGCGTGCTGAACGACATCCTGAGCCGGCTGGACCCTCCCGAGGCCGAGGTGCAGATCGACCGGCTGATCACTGGCCGGCTGCAGAGCCTGCAGACCTACGTGACCCAGCAGCTGATCCGGGCCGCCGAGATTCGGGCCAGCGCCAACCTGGCCGCCACCAAGATGAGCGAGTGCGTGCTGGGCCAGAGCAAGCGGGTGGACTTCTGCGGCAAGGGCTACCACCTGATGAGCTTTCCCCAGAGCGCACCCCACGGAGTGGTGTTCCTGCACGTGACCTACGTGCCCGCCCAGGAGAAGAACTTCACCACCGCCCCAGCCATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACCCATTGGTTCGTGACACAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCTCTGCAGCCCGAGCTGGACAGCTTCAAAGAGGAACTGGACAAGTACTTTAAGAACCACACAAGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAGAAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTGCAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCCTGGTACATCTGGCTGGGCTTTATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGCTGTAGCTGCCTGAAGGGCTGTTGTAGCTGTGGCAGCTGCTGCAAGTTCGACGAGGACGATTCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACACATGATGACTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCAAAAAAAAAAAAAGAAGAGCTCCAACCGGTGTGGTAGCTCCGCCGTTTAACATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGAGATCCAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCTGTTCATGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAACGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAATCCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAACATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCCCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAGGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATTAATACGACTCACTATAAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATGTTCGTGTTCCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGTGTGAACCTGACCACAAGAACACAGCTGCCTCCAGCCTACACCAACAGCGTTACCAGAGGCGTGTACTACCCCGACAAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGCAACGTGACCTGGTTCCACGCCATCTCCGGCACCAATGGCACCAAGAGATTCGACAACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATCATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTGAACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTCCTGGACGTCTACTACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTACAGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAAGGCAAGCATGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTTAAGAACATCGACGGCTACTTCAAGATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTCTCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACACTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCTGGTGCCGCCGCTTACTATGTGGGCTACCTGCAGCCTAGAACCTTCCTGCTGAAGTACAACGAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGATCCTCTGAGCGAGACAAAGTGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTGCAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAGGTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCTGAAGCGGATCAGCAATTGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTACGGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTCGTGATCCGGGGAAACGAAGTGCGGCAGATTGCCCCTGGACAGACAGGCAACATCGCCGACTACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAGCTGGACTCCAAAGTCGGCGGCAACTACAATTACAGGTACCGGCTGTTCCGGAAGTCCAATCTGAAGCCCTTCGAGCGGGACATCTCCACCGAGATCTATCAGGCCGGCAACAAGCCTTGTAACGGCGTGGCAGGCGTGAACTGCTACTTCCCACTGCAGTCCTACGGCTTTAGGCCCACATACGGCGTGGGCCACCAGCCCTACAGAGTGGTGGTGCTGAGCTTCGAACTGCTGCATGCCCCTGCCACAGTGTGCGGCCCTAAGAAAAGCACCAATCTCGTGAAGAACAAATGCGTGAACTTCAACTTCAACGGCCTGACCGGCACCGGCGTGCTG

 

Interessanterweise weist diese Moderna-Impfstoffvektorsequenz eine zu 99,8 % identische Sequenz zu den Plasmiden auf, die in Of interest, this Moderna vaccine vector sequence has 99.8% identical sequence to the plasmids discovered in Proben von Pseudomonas aeruginosa entdeckt wurdenPseudomonas aeruginosa samplesdie bekanntermaßen vom NCBI herausgegeben wurden, nachdem die Spike-Proteinsequenz darin identifiziert wurde. Zu dieser Zeit gab es eine lebhafte Debatte darüber, ob diese Plasmide ohne Antibiotika-Selektionsdruck in hoher Kopienzahl in ihrem Wirt verbleiben würden. Die Abdeckungstiefe für die Spike-enthaltenden Plasmide war 10-mal geringer als die Pseudomonas-Genom-Reads, während andere native Pseudomonas-Plasmide eine 50-mal höhere Abdeckung als das Pseudomonas-Genom aufwiesen. Dies führte mich zu der Annahme, dass dieses Spike-Plasmid eher ein Kontaminationsereignis während des Sequenzierungsprozesses war, da Plasmide mit hoher Kopienzahl eine höhere Kopienzahl aufweisen sollten als ihre Wirtsgenome, wie durch die in der Anordnung vorhandenen nativen Pseudomonas-Plasmide belegt. Dies bleibt eine ungeklärte Debatte. which were famously edited from NCBI after spike protein sequence was identified in them. At the time, there was a healthy debate regarding if these plasmids would remain at high copy number in their host without any antibiotic selective pressure. The depth of coverage for the spike containing plasmids was 10X lower than the pseudomonas genome reads while other native pseudomonas plasmids were 50X higher in coverage than the pseudomonas genome. This led me to believe this spike plasmid was more likely a contamination event during the sequencing process as high copy plasmids should have higher copy number than their host genomes as evidenced by the native pseudomonas plasmids present in the assembly. This remains an unsettled debate.

Ich hatte nicht bedacht, ob die Patienten in dieser Pseudomonas-Studie mit einem Impfstoff geimpft worden waren, der große Mengen kontaminierender Expressionsplasmide enthielt. Wie lange replizieren sich diese Plasmide in Säugersystemen ohne Neo- oder Kan-Selektion? Wurden diese Patienten aufgrund ihrer Pseudomonas-Infektion jemals mit solchen Antibiotika behandelt? Hätte diese Auswahl funktioniert, da viele Pseudomonaden bereits von Natur aus resistent gegen Neo und Kan sind? Der Mangel an öffentlicher Transparenz über diese haftungsfreien Produkte lässt viele Fragen offen.I had not considered if the patients in this pseudomonas study had been vaccinated with a vaccine containing high amounts of contaminating expression plasmids. How long do these plasmids replicate in mammalian systems without Neo or Kan selection? Were these patients ever treated with such antibiotics due to their pseudomonas infection? Would this selection have worked given many pseudomonas are natively resistant to Neo and Kan already? The lack of public transparency on these liability free products leaves many questions.

Abbildung 8. BLAST-Alignment des Moderna-Vektors zum Pseudomonas-Vektor.Figure 8. BLAST alignment of the Moderna vector to the Pseudomonas vector.

Pfizer-Expressionsvektor, der in Pfizer expression vector blasted to Pseudomonas aeruginosa Pseudomonas aeruginosa-Spike-Plasmid gestrahlt wurde. spike plasmid.

Abbildung 9. BLAST-Analyse des Pfizer-Vektors zum Pseudomonas-Vektor.Figure 9. BLAST analysis of the Pfizer vector to the Pseudomonas vector.

Die EMA hat Grenzwerte für die dsDNA-Kontamination auf weniger als 330 ng/mg RNA festgelegt. Dies ist ungefähr 1 Teil pro 3.030 mRNA-Moleküle. Es ist nicht klar, wie sie diese Standards festlegen. Beispielsweise würde ein Schuss, der 34 Billionen mRNAs mit einer Plasmidkontaminationsrate von 1 Teil pro 3.000 enthält, einer Transfektion von über 10 Milliarden antibiotikaresistenten Plasmiden pro Patient entsprechen. Die Sequenzierungsbeweise, die wir jetzt zur Hand haben, bestätigen, dass der größte Teil dieser DNA tatsächlich die Expressionsplasmid-DNA ist, komplett mit Spike-Protein, SV40-Säugetier-Expressionspromotoren, Aminoglykosid-Antibiotikaresistenz und Replikationsursprüngen mit hoher Kopienzahl, die sowohl mit der Säugetierexpression als auch kompatibel sind bakterielle Verstärkung.The EMA set limits for dsDNA contamination at less than 330ng/mg RNA. This is roughly 1 part per 3,030 mRNA molecules. It is not clear how they set these standards. For instance, a shot containing 34 trillion mRNAs with a 1 part per 3,000 plasmid contamination rate would equate to over 10 billion antibiotic resistant plasmids being transfected per patient. The sequencing evidence we now have on hand confirms that most of this DNA is in-fact the expression plasmid DNA, complete with spike protein, SV40 mammalian expression promoters, aminoglycoside antibiotic resistance and high copy origins of replication that are compatible with both mammalian expression and bacterial amplification.

Man kann das relative Verhältnis des Vektors zu den Insert-Nucleinsäuren schnell abschätzen, indem man die maximale Abdeckungstiefe des Inserts gegenüber dem Vektor betrachtet. Moderna Vial 2 hat eine 739-fache maximale Abdeckung über dem Vektor und eine 2,2-Millionen-fache Abdeckung über dem Einsatz. Dies entspricht 1 Vektor pro 3.000 mRNAs.One can make a quick estimate of the relative ratio of the vector to insert nucleic acids by looking at the maximum depth of coverage of the insert versus the vector. Moderna vial 2 has 739X maximum coverage over the vector and 2.2 million X coverage over the insert. This equates to 1 vector for every 3,000 mRNAs.

Abbildung 10. Read-Tiefenanalyse von Moderna-Fläschchen 2 für die Vektor- und Insertsequenzen.Figure 10. Read depth analysis of Moderna vial 2 for the vector and insert sequences.

Die Fläschchen von Pfizer weisen eine um eine Größenordnung höhere Kontaminationsrate auf. Dies stimmt damit überein, dass die Fragmentanalyse mehr Off-Target-Peaks aufweist.The Pfizer vials have an order of magnitude higher rates of contamination. This is consistent with the fragment analysis having more off-target peaks.

Abbildung 11. Analyse der Lesetiefe des bivalenten Fläschchens von Pfizer 1.Figure 11. Read Depth analysis of the Pfizer bivalent vial 1.

Da mit dieser Methode sowohl DNA als auch RNA gemessen werden, sollten diese Schätzungen mit qPCR unter Verwendung von DNase und RNasen bestätigt werden, um das Verhältnis zu verfeinern. Nun, da die Sequenz der kontaminierenden Nukleinsäure oben veröffentlicht wurde, können diese Assays erstellt und verwendet werden, um die Kontamination von Charge zu Charge zu überwachen.Since both DNA and RNA are being measured with this method, these estimates should be confirmed with qPCR using DNase and RNases to refine the ratio. Now that the sequence of the contaminating nucleic acid is published above, these assays can be built and used to monitor lot to lot contamination.

Man kann die Strangigkeitsinformationen in den Sequenzierungsdaten entnehmen und erkennen, welche Teile der Anordnung aus Watson- und Crick-Strängen (DNA) bestehen und welche Teile hauptsächlich Crick-Stränge (Sense-Stränge oder mRNA) enthalten. Sie können sehen, dass diese Analyse den T7-Promotor an Base 2200 im Moderna-Vial-1-Vektor lokalisiert. Dies ist ein eindeutiger Beweis dafür, dass die kontaminierende Vektorsequenz doppelsträngige DNA und nicht RNA ist.One can take the strandedness information in the sequencing data and discern which parts of the assembly are comprised of watson and crick strands (DNA) and which parts contain mostly crick strands (sense strands or mRNA). You can see this analysis pinpoints the T7 Promoter at base 2200 in the Moderna vial 1 vector. This is unequivocal evidence that the contaminating vector sequence is double stranded DNA and not RNA.

Abbildung 12. Watson vs. Crick Read Tiefenanalyse. Wenn Crick-Strangabdeckung minus Watson-Strangabdeckung = 0, haben Sie DNA. Wenn es unausgeglichen ist, haben Sie hauptsächlich Sinnstrang-mRNA.Figure 12. Watson vs Crick Read depth analysis. When Crick strand coverage minus Watson strand coverage = 0, you have DNA. When it’s imbalanced, you have mostly sense strand mRNA.

 

Was in den EMA-Dokumenten nicht gezeigt wird, ist die Effizienz der Linearisierung dieses Plasmids, was dazu beitragen kann, seine Fähigkeit zur Amplifikation im Wirt zu begrenzen. What is not shown in the EMA documents is the efficiency of linearizing this plasmid which may help to limit its capacity to amplify in the host. Es gibt viele lineare amplifizierbare Plasmide Many linear amplifiable plasmids exist, und dies garantiert in keiner Weise eine schnellere Clearance des Plasmids, aber es sollten Methoden beschrieben werden, um die Effizienz und den Abschluss dieses Schritts des Impfstoffherstellungsverfahrens sicherzustellen. and this in no way guarantees faster clearance of the plasmid but methods should be described to ascertain the efficiency and completion of this step of the vaccine manufacturing process.

Die Paired-End-Reads in dieser Studie können helfen, The paired-end reads in this study may help to diese Frage zu beantworten answer this question, da der von uns verwendete Assembler nicht darauf programmiert war, die Zirkularität der Contigs zu bewerten. as the assembler we utilized was not programmed to assess circularity of the contigs.

Abbildung 13. Die EMA-Rest-DNA-Matrizenrichtlinien werden mit der Kontamination, die in sequenzierten Pfizer-Fläschchen beobachtet wird, nicht erfüllt.Figure 13. EMA residual DNA template guidelines are not met with the contamination seen in Pfizer vials sequenced.

 

TranskriptionsfehlerTranscriptional error

Die Sequenzierungsdaten übersteigen die 1-Millionen-fache Abdeckung der mRNAs. Die vertikalen farbigen Hash-Markierungen in den grauen horizontalen Lesezeichen (unterhalb des IGV-Screenshots) sind Fehler. Diese Fehler können auf mehrere Faktoren zurückzuführen sein.The sequencing data exceeds 1 million X coverage over the mRNAs. The vertical colored hash marks in the grey horizontal reads (below IGV screenshot) are errors. These errors can be a result of multiple factors.

1) Fehleinbau von T7-Polymerase während der Synthese von Impfstoff-mRNA aus den Expressionsplasmiden, die diese Impfstoffe kontaminieren. Da dieser Schritt das fehleranfällige Nukleotid m1Ψ verwendet, wird erwartet, dass Transkriptionsfehler um 200–300 % zunehmen (Chen 1)T7 polymerase mis-incorporations while synthesizing vaccine mRNA from the expression plasmids found contaminating these vaccines. Since this step uses the error prone nucleotide m1Ψ, transcriptional errors are expected to increase 200-300% (Chen et al. et al).).

2) Reverse Transkriptase, die verwendet wird, um diese modifizierte mRNA in DNA für die Illumina-Sequenzierung umzuwandeln. Diese RT-Enzyme sind als fehleranfällig bekannt (10^-4). Ihre Fehlerquote steigt wahrscheinlich mit der Verwendung von m1Ψ als Vorlage.2)Reverse Transcriptase used to turn this modified mRNA into DNA for Illumina sequencing. These RT enzymes are known to be error prone (10^-4). Their error rate likely increases with the use of m1Ψ as a template.

3) PCR- und Sequenzierungsfehler. Diese Fehler können erkannt und behoben werden, indem doppelte Lesevorgänge, optische Duplikate und Qualitätsfilterung des Sequenzierungsdatums eliminiert werden.3)PCR and sequencing error. These errors can be detected and addressed by eliminating duplicate reads, optical duplicates and quality filtering the sequencing date.

Es wird interessant sein, die Sequenzierungsfehler im DNA-Plasmid-Rückgrat im Vergleich zu den im Spike-Protein beobachteten Sequenzierungsfehlern zu überwachen, da dies helfen würde, die Fehlerquelle zu beheben. Das Plasmidrückgrat wird genauer als DNA repliziert und wurde niemals von m1Ψ-Matrizen abgeleitet. Die mRNA wird 2 Polymeraseschritte mit einem Low-Fidelity-Nukleotid (m1Ψ) durchlaufen haben. Ein Vergleich der Fehlerraten in der Hauptkette des Plasmids mit den Fehlerraten in der transkribierten Region des Plasmids würde helfen, den durch die Verwendung eines fehleranfälligen Nukleotids induzierten Fehler aufzuschlüsseln.It will be interesting to monitor the sequencing errors in the DNA plasmid backbone compared to the sequencing errors seen in the spike protein as this would help to resolve the source of the error. The plasmid backbone is more faithfully replicated as DNA and has never been derived from m1Ψ templates. The mRNA, will have gone through 2 polymerase steps with a low fidelity nucleotide (m1Ψ). A comparison of the error rates in the backbone of the plasmid vs the error rates in the transcribed region of the plasmid would help itemize the error induced with the use of an error prone nucleotide.

Angesichts der hohen Abdeckungstiefe wird sich die zukünftige Arbeit auf die Q30-Filterung (1 Fehler pro 10^3) ​​aller Lesevorgänge konzentrieren, um Fehler zu eliminieren, die durch den Sequenzer eingeführt werden könnten, und neu zu bewerten, ob Transkriptionsfehler ohne UMIs erkannt werden können.Given the high depth of coverage, future work will focus on Q30 filtering (1 error per 10^3) all of the reads to eliminate errors that could introduced by the sequencer and reassess if transcriptional error can be detected without UMIs.

Abbildung 14. Auf die Megahit-Baugruppe des Bivalent-Impfstofffläschchens 1 von Moderna zurückgeführte Reads.Figure 14. Reads mapped back to the Megahit assembly of the Moderna Bivalent vaccine vial 1.
Abbildung 15. Reads, die den Megahit-Anordnungen zugeordnet sind, liefern zwei Haplotypen für das Spike-Protein. Wuhan-1 und Omicron sind so weit auseinandergegangen, dass der Assembler diese Spike-Proteinsequenz in zwei Contigs aufteilt.Figure 15. Reads mapped back to the megahit assemblies delivers two haplotypes for the spike protein. Wuhan-1 and Omicron are diverged enough that the assembler splits these Spike protein sequence into two contigs.

Um Transkriptionsfehlerraten zu erfassen, die auf 1:3.000–4.000 in der von Chen To survey transcriptional error rates estimated to be 1:3,000-4,000 in frequency described by Chen et al et al. beschriebenen Häufigkeit geschätzt werden, sind häufig eindeutige molekulare Identifikatoren ( ., Unique Molecular Identifiers are often (UMIs) erforderlich UMIs) required..

Abbildung 16. Darstellung von UMIs für fehlerkorrigierende Lesevorgänge.Figure 16. depiction of UMIs for error correcting reads.

Diese Arbeit wurde durchgeführt, um eine Ausgangssequenz für die bivalenten Impfstoffe festzulegen, und wurde nicht mit UMIs entwickelt. Zukünftige Arbeiten könnten dies untersuchen.This work was performed to establish a baseline sequence for the bivalent vaccines and was not designed with UMIs. Future work may explore this.

 

DiskussionDiscussion

Die Kontamination von doppelsträngiger DNA (dsDNA) in diesen Impfstoffen ist ein erhebliches Problem. Die EMA hat dsDNA-Grenzwerte in diesen Impfstoffen unter 0,33 % (330 pg/mg) festgelegt. Das ist ungefähr 1 DNA-Molekül für 3.000 mRNA-Moleküle. Während die Moderna-Impfstoffe diese Spezifikation erfüllen, weisen die Pfizer-Impfstoffe eine 10-mal höhere Kontamination mit 1 DNA-Molekül pro 350 mRNAs auf. Dies ist 1 replikationsfähiges Plasmid pro 350 mRNA-Moleküle und entspricht Milliarden von Antibiotika-resistenten Plasmiden, die pro Person und Schuss injiziert werden.Contamination of double stranded DNA (dsDNA) in these vaccines is a significant concern. The EMA specified dsDNA limits in this vaccines below 0.33% (330pg/mg). This is roughly 1 DNA molecule for 3,000 mRNA molecules. While the Moderna vaccines are meeting this specification, the Pfizer vaccines are 10 fold higher in contamination with 1 DNA molecule per 350 mRNAs. This is 1 replication competent plasmid per 350 mRNA molecules and equates to billions of antibiotic resistant plasmids injected per person per shot.

Es gibt Bibliothekskonstruktionsartefakte, die die Bewertung von Transkriptionsfehlern verzerren könnten. Es ist bekannt, dass m1Ψ Polymerasen blockiert und höhere Raten von Polymerasefehlern induziert. Dies kann eine effizientere Erststrangsynthese aus der Plasmid-DNA im Vergleich zu der modifizierten RNA ermöglichen. Solch hohe Grade an Polymerase-Hemmung würden jedoch Fragen bezüglich der Genauigkeit der Transkription unter Verwendung von m1Ψ aufwerfenThere are library construction artifacts that might skew the assessment of transcriptional error. m1Ψ is known to stall polymerases and induce higher rates of polymerase error. This may enable more efficient first strand synthesis from the plasmid DNA compared to the modified RNA. However, such high levels of polymerase inhibition would raise questions regarding the fidelity of the transcription using m1Ψ

Die EMA hatte guten Grund, die dsDNA-Spiegel in den Impfstoffen zu überwachen. DsDNA-Injektionen können The EMA had good reason to monitor the dsDNA levels in the vaccines. DsDNA injections can induce bei Säugetieren über STING Typ-I-Interferon-Antworten induzieren. type I interferon responses via STINGWenn diese dsDNAs in LNPs verpackt werden, können sie sowohl Säugetier- als auch Bakterienzellen im Mikrobiom des Patienten transfizieren und transformieren. Es ist nicht klar, wie sich die EMA auf ihre akzeptable dsDNA-Kontamination geeinigt hat und ob sie in Betracht gezogen hat, DNA zu kontaminieren, die im Wirt amplifizieren kann. in mammals. If these dsDNAs are packaged into LNPs, they can transfect and transform both mammalian and bacterial cells in the patients microbiome. Its not clear how the EMA settled on their acceptable dsDNA contamination and if they had considered contaminating DNA that was capable of amplifying inside the host.

Die Vektoren enthalten Säuger-Promotoren, bakterielle Replikationsursprünge zusätzlich zu den Neomycin- und Kanamycin-Resistenzgenen. Zirkuläre Plasmide wie dieses werden für eine stabile Transfektion und fortgesetzte Expression von Genen in Säugerzellen mit dem starken SV40-Promotor verwendet. Dies könnte bei Patienten, denen diese Konstrukte injiziert wurden, zu einer verlängerten Spike-Expression führen. Mit diesen Plasmiden transformierte Bakterien würden 50–300 Kopien des Plasmids pro Zelle replizieren. Es ist nicht bekannt, ob die Bakterien auch das Spike-Protein in diesen Plasmiden exprimieren würden, aber das Vorhandensein von T7-Promotoren in einigen der Vektoren impliziert, dass dies wahrscheinlich ist.The vectors contain mammalian promoters, bacterial origins of replication in addition to the neomycin and kanamycin resistance genes. Circular plasmids like this are used for stable transfection and continued expression of genes in mammalian cells with the strong SV40 promoter. This could lead to prolonged spike expression in patients injected with these constructs. Bacteria transformed with these plasmids would replicate 50-300 copies of the plasmid per cell. It is not know if the bacteria would also express the spike protein in these plasmids but the presence of T7 promoters in some of the vectors implies this is likely.

Die Verwendung von Neomycin oder Kanamycin durch Patienten nach der Impfung mit diesen Plasmiden könnte die Selektion von Neomycin- und Kanamycin-resistenten Bakterien im Darmmikrobiom ermöglichen. Es ist unklar, ob das Spike-Protein in diesen Expressionsvektoren in Bakterien exprimiert wird. Dennoch könnte die Impfung von Milliarden von Menschen mit Plasmiden mit doppelter Antibiotikaresistenz und hoher Kopienzahl ein Rückschritt in unserem Kampf gegen Antibiotikaresistenzen sein. Transformieren diese Expressionsvektoren das Darmmikrobiom? Wie viele Kopien der Säuger-Plasmid-Expressionsvektoren werden nach der Impfstoff-Transfektion repliziert?Patient use of neomycin or kanamycin after vaccination with these plasmids could enable the the selection of neomycin and kanamycin resistant bacteria in the gut microbiome. It is unclear if the spike protein in these expression vectors is expressed in bacteria. Nevertheless, inoculating billions of people with dual antibiotic resistance, high-copy number plasmids could be a step backwards in our fight against antibiotic resistance. Do these expression vectors transform the gut microbiome? How many copies of the mammalian plasmid expression vectors are replicated post vaccine transfection?

Arkmedic deckt eine Arkmedic covers a Bioverteilungsstudie ab biodistribution study, die die LNP-Lokalisierung im Dickdarm innerhalb von 48 Stunden demonstriert. Selbst wenn sich 1 % der LNPs im Darm ansiedeln, könnten Bakterien diese Plasmide angesichts des Replikationsursprungs mit hoher Kopienzahl in den Vektoren auf weit höhere Niveaus amplifizieren. Während LNPs bei der Transfektion von Säugerzellmembranen wirksamer sind als Bakterienzellwände, werden die meisten that demonstrates LNP localization to the large intestine in 48hrs. Even if 1% of the LNPs localize to the intestines, bacteria could amplify these plasmids to far higher levels given the high copy origin of replication in the vectors. While LNPs are more effective at transfection of mammalian cell membranes than bacterial cell walls, most E. coli E.colibei 37°C leicht mit nackter DNA transformiert. Patienten mit Fieber verbessern die Transformationseffizienz. is readily transformed at 37C with naked DNA. Patients with fevers will improve the transformation efficiency.

Jessica Rose bemerkte (persönliche Mitteilung), dass in ihrer Beschreibung über 40 Patienten bei VAERs mit Neomycin oder Kanamycin eingereicht wurden. Diese Zahl ist schwer in einen Zusammenhang zu stellen, da nicht alle VAER-Einreichungen den Einsatz von Antibiotika durch die Opfer beinhalten. Jessica Rose noted (personal communication) there are over 40 patient submission to VAERs with Neomycin or Kanamycin in their description. This number is hard to place into context as not all VAERs submissions include the antibiotic use of the victims.

Zusammenfassend lässt sich sagen, dass es wenige öffentliche Informationen über die in diesen Impfstoffen verwendete Sequenztreue und Nukleinsäurereinheit gibt. Unseres Wissens ist dies die erste Tiefensequenzierung dieser Produkte und das erste Mal, dass Expressionsplasmide in den Impfstoffen entdeckt wurden. Dies sind starke Verunreinigungen in den Impfstoffen, die Kindern verabreicht werden. Milliarden dieser Verunreinigungen pro Injektion sind wahrscheinlich eine Unterschätzung ihrer Gesamtbelastung, da sich diese Plasmide in bakteriellen Wirten selbst replizieren können. In summary, there is a paucity of public information on the sequence fidelity and nucleic acid purity used in these vaccines. To our knowledge, this is the first deep sequencing of these products and the first time expression plasmids have been discovered in the vaccines. These are potent contaminants in the vaccines being administered to children. Billions of these contaminants per injection is likely an under estimate of their the entire burden as these plasmids can self replicate in bacterial hosts. Mehrere StudienMultiple studies haben eine verlängerte Impfstoff-mRNA-Clearance gezeigt. Dies könnte das Ergebnis des m1Ψ in der mRNA oder der Transfektion oder Transformation von DNA-basierten Expressionsvektoren sein. Die Einführung von Milliarden von Antibiotikaresistenzgenen in replikationsfähige Plasmide mit hoher Kopienzahl sollte Bedenken hinsichtlich einer Beschleunigung der globalen Antibiotikaresistenz hervorrufen.have demonstrated prolonged vaccine mRNA clearance. This could be the result of the m1Ψ in the mRNA or the transfection or transformation of DNA based expression vectors. The introduction of billions of antibiotic resistance genes in high copy replication competent plasmids should evoke concerns over accelerating global antibiotic resistance.

Bestätigungen.Acknowledgements.

Ich möchte dankenI’d like to thank

, Sabine Hazan, Jikkyleaks, @pathogenetics, Steve Massey, Valentine Bruttel, Lynn Fynn,, Sabine Hazan, Jikkyleaks, @pathogenetics, Steve Massey, Valentine Bruttel , Lynn Fynn,

Und and

für hilfreiche Kommentare zu diesem Thema. Diese Daten sollten als Baugruppenentwürfe betrachtet werden. Weitere Arbeiten sind erforderlich, um die Haplotypen von Omicron und Wuhan-1 aufzuteilen und die Schätzungen von linearer zu zirkulärer DNA, die in den Impfstoffen vorhanden ist, zu verfeinern. Die Fehlerratenanalyse und die Artefakte der Hintergrundsequenzierung können durch Gemeinschaftsanstrengungen weiter verfeinert werden. Fühlen Sie sich frei, unten Kommentare zu hinterlassen. for helpful comments on this topic. These data should be considered draft assemblies. Further work is required to split the Omicron and Wuhan-1 haplotypes and refine the estimates of linear to circular DNA that is present in the vaccines. Error rate analysis and background sequencing artifacts may be further refined through a community effort. Feel free to leave comments below.


SequenzierungsdatenSequencing Data

Raw Illumina liestRaw Illumina Reads

Gelesene Dateien werden durch sha256 (Hash und Stash) geleitet und in die DASH-Blockchain geätzt. Der SHA256-Hash der gelesenen Datei wird in den OP_RETURN eines unveränderlichen Ledgers ausgegeben. Wenn der Hash der Datei nicht mit dem Hash in diesen Transaktionen übereinstimmt, wurde die Datei manipuliert.Read files are run through sha256 (Hash and stash) and etched onto the DASH blockchain. The SHA256 hash of the read file is spent into the OP_RETURN of an immutable ledger. If the hash of the file doesnt match the hash in these transactions, the file has been tampered with.


Megahit-AssembliesMegahit Assemblies

 

Illumina Reads werden Megahit Assemblies zugeordnetIllumina Reads mapped back to Megahit Assemblies


Q30 Gefilterte Illumina-Reads (verwenden Sie diese für Schätzungen der Transkriptionsfehlerrate)Q30 Filtered Illumina Reads (use these for transcriptional error rate estimates)

FastQ-Filter herunterladen FastQ-Filter download: Verwendung> fastq-filter -e 0.001 -o output.fastq input.fastq: usage> fastq-filter -e 0.001 -o output.fastq input.fastq

Q30 BAM-Dateien. Q30-Reads, die Megahit-Assemblys zugeordnet sindQ30 BAM files. Q30 Reads mapped against Megahit assemblies



IGVtools-Fehler basierend auf q30-LesevorgängenIGVtools error by base on q30 reads

Felder = Position im Contig, positiver Stand (+)A, +C, +G, +T, +N, +Löschung, +Einfügung, negativer Strang -A, -C, -G, -T, -N, -Löschung , -EinfügungFields = Position in contig, Positive stand (+)A, +C, +G, +T, +N, +Deletion, +Insertion, Negative strand -A, -C, -G, -T, -N, -Deletion, -Insertion

Moderna-Phiole 1Moderna Vial 1

Moderna-Phiole 2Moderna Vial 2

Pfizer-Fläschchen 1Pfizer Vial 1

Pfizer-Fläschchen 2Pfizer Vial 2


 

Andere Referenzen-Other references-

  1. BNT-CMC-Peer-ReviewerBNT-CMC-Peer-Reviewer
  2. BNT162b2_EMA-Peer-ReviewBNT162b2_EMA-Peer-Review
  3. BNT162b2-Analytical_Methods_TransferBNT162b2-Analytical_Methods_Transfer
  4. BMJ_rezensionBMJ_review
  5. Berichterstatter-Rolling-Review-Bericht Rapporteur-Rolling-Review-Report1 1
  6. Berichterstatter-Rolling-Review-Bericht Rapporteur-Rolling-Review-Report 22
  7. Berichterstatter-Rolling-Review-Bericht Rapporteur-Rolling-Review-Report3 3
  8. Andere Links von COVID_TRUTHSOther links from COVID_TRUTHS
  9. Peer-Review-KommentarePeer Review Comments

Andrew Bostom ist ein großartiger Beobachter der Debatte über C19 vs. mRNA-Myokarditis.Andrew Bostom is a great follow on the C19 vs mRNA myocarditis debate-


Like it? Share with your friends!

9917
freeworldnews

0 Comments

Deine E-Mail-Adresse wird nicht veröffentlicht. Erforderliche Felder sind mit * markiert

Pin It on Pinterest

Translate »
Choose A Format
Personality quiz
Series of questions that intends to reveal something about the personality
List
The Classic Internet Listicles
Open List
Submit your own item and vote up for the best submission
Ranked List
Upvote or downvote to decide the best list item
Meme
Upload your own images to make custom memes
Video
Youtube and Vimeo Embeds
Audio
Soundcloud or Mixcloud Embeds
Image
Photo or GIF
Gif
GIF format